Somatic cells undergo mitosis while sex cells (egg çell and sperms) go through meiosis.Cloning takes place when an adult nucleus iş transferred to an egg cell and is stimulated to dividecreating an exact copy of the adult source material, Today different animals are being cloned.LONG QUIZ #11. Cell grows to its mature size, makes a copy of its DNA, and get ready to divide2. Chromatin in the nucleus condenses to form chromosomes. The nuclear membrane breaksdown.3. Chromosomes line up across the center of the cell.4. The spindle fibers draws each chromatin to each pole of the cell.5. Chromosomes begin to stretch out and lose their rod-like appearance. A new nuclearmembrane forms around each region of chromosomes.6. Each daughter cell ends up with the same number of identical chromosomes and about halfthe organelles and cytoplasm.A. ANAPHASEB. CYTOKINESIS7. DNA coils into chromosomes, the nucleolus and nuclear envelope disappear, the mitoticspindle forms, and synapsis (crossing-over) occurs.8. Tetrads line up randomly along the midline, spindle fibers attach to the centromere of eachhomologous chromosome.9. Homologous chromosomes move to the opposite poles of the cell10. The chromosomes reach the opposite end of cell and cytokinesis begins11. Chromosomes move to the midline of the dividing cell, facing opposite poles of the dividingcellC. INTERPHASED. PROPHASEE. METAPHASEF. TELOPHASE12. The chromatids separate and move toward opposite poles of the cell.13. A nuclear membrane forms around the chromosomes in each of the 4 new cells.A. ANAPHASE IB. TELOPHASE 1 D. METAPHASE14. Occurs only in organisms that reproduce sexually.15. Sperm and egg cell.16. Chromosomes of the same size and function.18. Body cells19. Chromosome 1 to 2220. Identical daughter cells can continue on with the cell cycle.A. MITOSISB. MEIOSIS---E. ANAPHASE IIF. TELOPHASE IIG. PROPHASE IIH. METAPHASE IIC..PROPHASE II------C. AUTOSOMED. SOMATIC CELLSE. HOMOLOGUESF.ZYGOTEG. GAMETESained herein are considered as property of Westbridge Institute of Technology, Inc. Copying, reproducing or usage of these contentsinstitution for any reason shall give Westbridge Institute of Technology, Inc. the right to file legal action against the person/s and/orIved.ert

There are two types of cell division, mitosis and meiosis. Cell division is a process by which a…

1. Cell grows to its mature size, makes a copy of its DNA, and get ready to divide 2. Chromatin in the nucleus condenses to form chromosomes. The nuclear membrane bre down. 3. Chromosomes line up across the center of the cell. 4. The spindle fibers draws each chromatin to each pole of the cell. 5. Chromosomes begin to stretch out and lose their rod-like appearance. A new nuclear membrane forms around each region of chromosomes. 6. Each daughter cell ends up with the same number of identical chromosomes and about che organelles and cytoplasm. A. ANAPHASE C. INTERPHASE E. METAPHASE

1. Cell grows to its mature size, makes a copy of its DNA, and get ready to divide 2. Chromatin in the nucleus condenses to form chromosomes. The nuclear membrane bre down. 3. Chromosomes line up across the center of the cell. 4. The spindle fibers draws each chromatin to each pole of the cell. 5. Chromosomes begin to stretch out and lose their rod-like appearance. A new nuclear membrane forms around each region of chromosomes. 6. Each daughter cell ends up with the same number of identical chromosomes and about che organelles and cytoplasm. A. ANAPHASE C. INTERPHASE E. METAPHASE

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

The cell cycle results in the production of ______. four cells, each with the same amount of genetic material but with different genetic information two cells, each with the same amount of genetic material and the same genetic information four cells, each with the same amount of genetic material and the same genetic information two cells, each with the same amount of genetic material but with different genetic information
Match the type of cell division with the cell type. sec cells somatic cells 1. mitosis meiosis
The cells separate (cytokinesis) into two identical daughter cells. * 1 Cell wall Cytoplasmic membrane Nucleoid Replicated DNA 2 3 4 Step 1 Step 2 Step 3 Step 4 Step 5
What is the role of the spindle fibers during mitosis * They help separate the chromosomes. They break down the nuclear membrane. They duplicate the DNA
Chromatin condenses and supercols. Name: The nuclear envelope is broken. Kinetochore microtubules appear. Name: Chromosomes aligned at the cellular equator. Name:
1. Describe the cell cycle. Why do cells divide? Why are the resulting daughter cells from Mitosis genetically identical? How can abnormal (cancerous) growth cell growth be prevented?
What is the function of the replication enzymes during S phase of the cell cycle?1. Holding the sister chromatids together until they are separated during mitosis2. Keeping the DNA tightly coiled3.Copying the DNA in the chromosomes4. Pushing the sister chromatids to opposite poles of the cell
1. It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT
Which of the explanations provided in the cartoon (A, B, C, or D) is more accurate and why? What is wrong with each of the other answers? Explain why each of the other answers is not a good choice.
Which is prophase, metaphase, anaphase, and telophase?