1- convert the following codes to assembly language:a) If (var1 < var2) {var3 = 10;}else if (var1 == var2) {var3 = 6;var4 = 7;}else {var3 = 0; }b) switch (x){case 50:case 52:result = 20;break;case 53:result = 13;break;case 54:result *= 3;break;default:result += 10; }c) Var = 3;While(var<=3)Var++;Print ("Sorry you have exceeded 3 trials");d) if (al > bl) OR (bl > cl)AX = 1;

Name: 1- convert the following codes to assembly language:a) If (var1 < var
Uploaded: 2024-03-20T06:51:23.000Z
Channel: Bartleby
Description: 1- convert the following codes to assembly language:a) If (var1 < var2) {var3 = 10;}else if (var1 == var2) {var3 = 6;var4 = 7;}else {var3 = 0; }b) switch (x){case 50:case 52:result = 20;break;case 53:result = 13;break;case 54:result *= 3;break;defau

a) main: # push rbp mov rbp, rsp…

Engineering

Computer Science

1- convert the following codes to assembly language: a) If (var1 < var2) { var3 = 10;} else if (var1 == var2) { var3 = 6; var4 = 7;} else {var3 = 0; } b) switch (x) { case 50: case 52: result = 20; break; case 53: result = 13; ak; case 54: result *= 3; break; default: result += 10;} c) Var = 3; While(var<=3) Var++; Print ("Sorry you have exceeded 3 trials"); d) if (al > bl) OR (bl > cl) AX = 1;

1- convert the following codes to assembly language: a) If (var1 < var2) { var3 = 10;} else if (var1 == var2) { var3 = 6; var4 = 7;} else {var3 = 0; } b) switch (x) { case 50: case 52: result = 20; break; case 53: result = 13; ak; case 54: result *= 3; break; default: result += 10;} c) Var = 3; While(var<=3) Var++; Print ("Sorry you have exceeded 3 trials"); d) if (al > bl) OR (bl > cl) AX = 1;

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

// SumAndProduct.cpp - This program computes sums and products // Input: Interactive// Output: Computed sum and product #include <iostream>#include <string>void sums(int);void products(int);using namespace std; int main() { int number; cout << "Enter a positive integer or 0 to quit: "; cin >> number; while(number != 0) { // Call sums function here // Call products function here cout << "Enter a positive integer or 0 to quit: "; cin >> number; } return 0;} // End of main function// Write sums function here// Write products function here
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
C programming: When running the code, why did the output turn 55? int sum(int k);int main() { int result = sum(10); printf("%d", result); return 0;}int sum(int k) { if (k > 0) { return k + sum(k - 1); } else { return 0; }}
Assignment: Simplifying C Code Description: Reduce the C snippet on the next page to the most basic components possible, as discussed in the lecture. For instance, please try to eliminate the following language components, replacing them only with if/goto blocks: ● for loop while loop ●. switch statement . curly brackets { } (other than those surrounding main) += and -= notation Once complete, test your code and the original code with a few different initial values! Deliverables: Your simplified C code, in a plaintext (.txt) file A screenshot of the simplified code running, showing it produces the same output as the original. Using BF computer language.
Upload answer sheets Test time left: 59:10 Design C program using switch and while statements, with two cases based on user choice, first choice, check whether three-digit number to be an Armstrong number or not. Second case to find whether number is even or not. A number is called an Armstrong number, if abc-a+b3+c, Only positive value has to be taken as an input, otherwise display warning message to the user. Na user defined function required. Provide sample input and expected output.
Problem Statement The barcode used by the U.S. Postal System to route mail is defined as follows: Each decimal digit in the ZIP code is encoded using a sequence of three half-height and two full-height bars. The barcode starts and ends with a full-height bar (the guard rail) and includes a checksum digit (after the five-digit ZIP code or ZIP + 4), computed by summing up the original digits modulo 10. Define the following functions: Draw a half-height or full-height bar on stddraw. Given a digit, draw its sequence of bars. Compute the checksum digit. Also define global code that read in a five- (or nine-) digit ZIP code as the command-line argument and draws the corresponding postal barcode.
Q1: Correct the following code, then list the functions of this code. const int Sensorl = A1 // analog pin const int Batt = A0; // analog pin const byte interruptpin = 2; void setup() { Serial.begin(6900): pinMode(interruptPin, INPUT); } void loop) { attachInterrupt(2,tilt sensor.RISING): } void send() { int valuel = analogRead(Sensol): float millivolts = (valuel / 1024.0) * 5000; celsius = millivolts / 10; Serial.printin(celseus); delay(1000); int valuel = analogRead(Batt) float Battery = (value2 / 1024.0) * 500; Battery-Battery/1000; Serial.printin(Battery); delay(1000); detachinterrupt(0); }
Convert the following to Pep/9 assembly: #include <iostream>using namespace std;int main(){ int number; cin >> number; if (number % 2 == 0) { cout << “Even\n”; } else { cout << “Odd\n”; } return 0;}
C Programming Language Assignment #4Introduction to C Programming – COP 3223Objectives1. To learn how to use loops for repeated execution2. To reinforce knowledge of If-Else statements for conditional executionIntroduction: Programmers for a Better TomorrowProgrammers for a Better Tomorrow is an organization dedicated to helping charities, medical societies, and scholarship organizations manage various tasks so that they can focus on making the world a better place! They have asked you and your classmates to help them develop some new programs to benefit their organizations.Problem: Scholarship Endowment Fund Part 2 (fund2.c)One division of Programmers for a Better Tomorrow is their Scholarship Endowment Fund. They provide yearly scholarships to students who need a hand in amounts of 1000, 500, and 250 dollars.The money for these scholarships comes from interest made on previous donations and investments. You will create a program to track the amount in the Fund as various donations…
Code on phyton: The program should accept a mass value (grams) for KMnO4. The program should display at the end the expected calculated mass of the four products produced by the reaction below. Assume H2SO4 and FeSO4 are excess reactants. The resulting output should be two decimal place only/ 2KMnO4 + 8H2SO4 + 10FeSO4 → K2SO4 + 5Fe2(SO4)3 + 2MnSO4 + 8H2O
please convert the code to C language#include <iostream>#include <fstream>#include<stdlib.h>#include <cstring>#include <iostream>#include <iomanip>using namespace std;string output;int count = 0;unsigned long int total_traversal = 0; class BitwiseRead {private: char buf; //int first; int nbits; //how many bits have been read from the buffer istream& in;public: /* Initialize a BitwiseRead that will use the given istream for input * */ BitwiseRead(istream & is); /* Fill the buffer from the input */ void fill(); /* Read the next bit from the bit buffer. Fill the buffer form the input * stream first if needed. * Return 1 if the bit read is 1, 0 if bit read is 0 * */ int readBit();}; BitwiseRead::BitwiseRead(istream & is) : in(is) { buf = 0; nbits = 8;} void BitwiseRead::fill() { buf = in.get(); nbits = 0;} int BitwiseRead::readBit() { if(nbits == 8) { fill(); } //uses a mask to extract the nbits'th…