What will be the output of the following C# code?1.static void Main(string[] args)2.{3.char ch = Convert. ToChar ('a' | 'b' | 'c');4.switch (ch)5.{6.case 'A':7.case 'a':8.Console.Nriteline("case Alcase a");9.break;10.case 'B':11.case 'b':12.Console.Writeline("case Blcase b");13.break;14.case 'C':15.case 'c':16.case 'D':17.case 'd':Console. Nriteline("case D|case d");18.19.break;20.21.Console. ReadLine();22.a) Compile time errorb) case A|case ac) case B|case bd) case D|case d

. What will be the output of the following C# code? 1. static void Main(string[] args) 2. { 3. char ch = Convert.ToChar('a' | 'b' | 'c'); 4. switch (ch) 5. { 6. case 'A': 7. case 'a': 8. Console.Writeline("case Alcase a"); 9. break; 10. case 'B': 11. case 'b': 12. Console. Writeline("case B|case b"); 13. break; 14. case 'C': 15. case 'c': 16. case 'D': 17. case 'd': 18. Console.Writeline("case D|case d"); 19. break; 20. 21. Console.ReadLine(); 22. } a) Compile time error b) case A|case a =) case B|case b d) case D|case d

. What will be the output of the following C# code? 1. static void Main(string[] args) 2. { 3. char ch = Convert.ToChar('a' | 'b' | 'c'); 4. switch (ch) 5. { 6. case 'A': 7. case 'a': 8. Console.Writeline("case Alcase a"); 9. break; 10. case 'B': 11. case 'b': 12. Console. Writeline("case B|case b"); 13. break; 14. case 'C': 15. case 'c': 16. case 'D': 17. case 'd': 18. Console.Writeline("case D|case d"); 19. break; 20. 21. Console.ReadLine(); 22. } a) Compile time error b) case A|case a =) case B|case b d) case D|case d

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

C++ - No library functions like atoi Write a machine language program to output your first name on the output device. Submit your "machine code" followed by a 'zz.' An example of the machine code to output "hello" is shown below. This is an example of what a machine language submission would look like: 50 00 48 50 00 65 50 00 6c 50 00 6c 50 00 6f 00 zz
Assignment #2 Instructions: Through this programming assignment, the students will learn to do the following: Learn to work with command line options and arguments Gain more experience with Makefiles Gain more experience with Unix Learn to use some of the available math funtions available with C Usage: mortgagepmt [-s] -r rate [-d downpayment] price In this assignment, you are asked to perform the mortgage payment calculation. All information needed for this will be passed to the program on the command line. There will be no user input during the execution of the program You will need a few pieces of information. The price of the home and the amount of the down payment. You will also need to know the interest rate and the term of the mortgage. To figure your mortgage payment, start by converting your annual interest rate to a monthly interest rate by dividing by 12. Next, add 1 to the monthly rate. Third, multiply the number of years in the term of the mortgage by 12 to calculate…
Assignment Name JavaScript Concepts III Assignment Filename lastname-circleArea.html (replace lastname with your last name). area.js Assignment Description This assignment demonstrates the following concepts: JavaScript Functions Assignment Instructions Write a JavaScript program that calculates the area of a circle: Write a function that calculates the area of a circle given the radius. Formula: Math.PI * (radius * radius) Your program code should contain appropriately named variables. Use documentation to identify various components of your program. Call the function once and pass a radius value of 10.75 to it. Use the starter files and complete the logic to satisfy the instructions. To access the files, download and save the circleArea.zip folder attached to this assignment. Then unzip the compressed folder to reveal the included files: circleArea.html and area.js. Be sure that the two files are in the same folder. Then write your code in the area.js…
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Drawa structured flowchart , C++, write pseudocode that describes the process of guessing a number between 1 and 100. After each guess, the player is told that the guess is too high or too low. The process continues until the player guesses the correct number. Pick a number and have a fellow student try to guess it following your instructions.
In C write a grading program as follows.- Ask the user for the number of students and store it in an integer variable.- Create an array of floats with four rows and columns equal to the number of students storedearlier.- Initialize the array to zeros.Create a menu with the following options (use a do-while loop and repeatedly display the menu):A or a to add student info one student at a timeT or t to display class average for homeworkS or s to display class average for quizzesB or b to display class average for examsZ or z to exit program (program repeats until this exit command is entered)
please code in python regular expression In some web forms, users must enter a phone number, and some of these aggravate users byaccepting only a specific format. You have been hired to write a program that reads U.S. phone numbers with the three-digit area and seven-digit local codes accepted as ten digits, or separated into blocks using hyphens or spaces, and with the area code optionally enclosed in parentheses. For example, all of these are valid: 555-123-1234, (555) 1234567, (555) 123 1234, and 5551234567. Read the phone numbers from user input and for each one echo the number in the form “(999) 999 9999” or report an error for any that are invalid, or that don’t have exactly ten digits.
C++ printSmaller is a function that accepts two int parameters and returns no value. It will print the value of the smaller one parameters. The function protoype is as follows: void printSmaller(int num1, int num2); write the statments to read two integers and call this function to display the smaller one.
IN C++ Write code that: creates 3 integer values - one can be set to 0, the other two should NOT multiples of one another (for example 3 and 6, or 2 and 8) take you largest value and perform a modulus operation using the smaller (non zero) value as the divisor print out the result. create an alias for the string type call the alias "name" then create an instance of the "name" class and assign it a value using an appropriate cout statement - print out the value Please screenshot your input and output, as the format tends to get messed up. Thank you!
structions: Write the following programs in C# using concepts learnt in this chapter and abmit the .cs file with the screenshot of your output for each question in the Lab Assignment 2 Submission page. 1. FRENCH TRANSLATOR Look at the following list of French words and their meanings: In French: gauche milieu droite middle In English: right left Create an application that translates the French words to English. The form should have three buttons, one for each French word. When the user clicks a button, the application should display the English translation in a Label control.
In C/C++, Which of the following statements is illegal? char b = 'c'; string c = "c"; char a = 'bob'; int i = 32;
Create a C++ Grocery Program according to this guideline: Linked List Functions Pointers Arrays The program must have a menu layout where the user can select certain action (Select Product, View My Cart, Check-Out, etc.) You must include all kinds of drinks/beverages Implement basic error tapping IYou must include the group name of the developers with the name of each developer (a total of 4) Group Name: In-Out Group Names: Cesar Rachel Jennifer Tom