Post lab 2

pdf

School

University of Texas, San Antonio *

*We aren’t endorsed by this school

Course

1122

Subject

Biology

Date

Apr 3, 2024

Type

pdf

Pages

Uploaded by reyflores58085

NAME: Reynaldo Flores IV, TT 9am-11:30am Post Lab #2: 75 points GRADING RUBRIC FOR QUESTION: Non mulƟple choice quesƟons Possible Points/QuesƟon Level of Understanding Synthesis of InformaƟon Use of SupporƟng Details Use of Accurate ScienƟfic Terminology Full Points Complete Understanding Complete synthesis of informaƟon, you connected all the dots! All details support your answer and every detail possible given Use of scienƟfic terminology enhances your response Half Points Average Understanding Average synthesis of informaƟon, you connected some of the dots Half supporƟng details give to jusƟfy your answer Some scienƟfic terminology Zero Points Minimal Understanding Minimal synthesis, you only have one dot No supporƟng details given to jusƟfy answer No scienƟfic terminology used

UV Mutagenesis and Mutant Hunt: 1.) What is a somaƟc mutaƟon? What is an autosome mutaƟon? What is a transversion mutaƟon? What is a visible mutaƟon? Can a mutaƟon be all of those at the same Ɵme? Explain your thinking: (7 points) A somaƟc mutaƟon is a geneƟc alteraƟon that transpires in the DNA of non-reproducƟve cells, excluding germ cells, and is not inherited by offspring. An autosomal mutaƟon occurs in the non-sex chromosomes, specifically chromosomes 1 through 22 in humans, potenƟally leading to various geneƟc disorders. A transversion mutaƟon is a type of point mutaƟon where a purine base is subsƟtuted with a pyrimidine base or vice versa, oŌen inﬂuenced by factors like ionizing radiaƟon. A visible mutaƟon results in observable changes in an organism's phenotype, such as altered physical traits. While a mutaƟon may be somaƟc, autosomal, and involve transversion, the term "visible mutaƟon" pertains to its phenotypic impact, and a mutaƟon is typically categorized based on specific criteria, rather than embodying all these classificaƟons simultaneously. 2.) How many amino acids in the following sequence aŌer translaƟon? Start translaƟng from the 1st nucleoƟde base (2 points) AATCGTACAAACGTGGATCAATTT There are 8 Amino acids. 3.) DNA sequence was CAA and mutates to CAG. The original DNA sequence provides a code for what amino acid? What amino acid is would be present in the translated pepƟde aŌer the mutaƟon? How does this impact the cell? (2 points) The original DNA sequence CAA codes for the amino acid glutamine, and when it mutates to CAG, the same amino acid, glutamine is sƟll encoded. The mutaƟon is considered a silent or synonymous mutaƟon as it does not result in a change in the amino acid sequence of the translated pepƟde. While this specific mutaƟon has a minimal impact on the cell, not all mutaƟons are silent, and some can lead to alteraƟons in the amino acid sequence, potenƟally affecƟng the structure and funcƟon of the protein. The consequences of mutaƟons vary, and some mutaƟons can have more significant impacts on cellular processes and funcƟons 4.) If you hit yeast cells with 250μJ, you’ll mutate gene #5 on chromosome #2 every Ɵme, explain if this is true or false. Again, explain your reasoning: (5 points) The statement is False When we expose yeast cells to a small amount of energy, like 250μJ, it doesn't mean that we will always cause a mutaƟon in a specific gene. MutaƟons induced by this kind of energy are not predictable and can happen randomly at various locaƟons in the yeast cell's geneƟc material. If we want to deliberately introduce specific mutaƟons, we need to use a more targeted approach called site directed mutagenesis. which involves using special tools, like mutaƟon-specific primers, to guide the mutaƟon to a parƟcular locaƟon. So, when we use an electric pulse like menƟoned earlier, mutaƟons can happen anywhere in the yeast cell's geneƟc material, including the region menƟoned in the quesƟon. The key is to carefully choose mutaƟons based on the traits or behaviors associated with them. 5.) Why do pyrimidine dimers have the potenƟal to cause mutaƟons? (5 points) In the process of DNA replicaƟon, polymerases may face challenges when encountering pyrimidine dimers. These structural abnormaliƟes can make it tough for polymerases to accurately replicate the DNA sequence, potenƟally resulƟng in errors such as inserƟons, deleƟons, or subsƟtuƟons during DNA synthesis. Pyrimidine dimers can disrupt transcripƟon by causing premature terminaƟon and interfering with proper gene expression. Overall, this kind of damage has the potenƟal to contribute to geneƟc instability, the development of cancer, and other adverse effects. 6.) Why do cells tolerate point mutaƟons beƩer than frameshiŌ mutaƟons? (5 points) Point mutaƟons involve the subsƟtuƟon of a single nucleoƟde, and this might not cause a significant alteraƟon in the structure of the protein. On the other hand, frameshiŌ mutaƟons disrupt the reading frame, leading to more substanƟal changes in the amino acid sequence, oŌen resulƟng in the creaƟon of nonfuncƟonal proteins. FrameshiŌ

mutaƟons tend to cause loss-of-funcƟon, and they are generally more harmful to cellular funcƟon compared to point mutaƟons. 7.) If you did/didn’t create any temperature sensiƟve mutants, explain how you did/didn’t, explain it in detail: (5 points) PCR: We didn't plan to make plates sensiƟve to temperature changes between 37°C and 30°C. When we checked them side by side, they looked almost the same. MutaƟons are random, and our plate cells just happened to not be affected by the temperatures we tested. 8.) What would be the effect on the PCR reacƟon if any of the following circumstances arose: 1) there are no primers in the reacƟon: (1 point) PCR would proceed normally Non-specific PCR of random templates will occur The reacƟon will cease aŌer a few cycles The PCR reacƟon will not commence 9.) From where does Taq polymerase come?: (1 point) Cambodia Bacteria that live in hydrothermal vents/hot springs The rainforest The CDC Label the steps in one cycle of PCR: #10-#12 (1 point each, 3 points total) Denaturing Annealing Extension

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

Module #2: 13.) Draw an appropriate gene model with the following informaƟon, be sure to label your diagram clearly, colors are helpful: (1.5 point each, 12 points) 3 exons, 2 introns, Gene direcƟon is +, 5’ UTR 3’ UTR, TSS, Inr MoƟf TATA, Box MoƟf Module #3: 14.) Define pre-mRNA: (2 points) Pre-mRNA is an early form of RNA made when a gene is transcribed. It contains exons and introns. Before it can guide protein producƟon the pre-mRNA undergoes modificaƟons such the removal of introns through a process called splicing. The final edited RNA, now mature mRNA, is what the cell uses as a blueprint for building proteins during translaƟon. 15.) Define mature mRNA: (2 points) Mature mRNA refers to the final processed and edited form of mRNA in eukaryoƟc cells. It is the result of various post transcripƟonal modificaƟons that occur to the iniƟal transcript in the pre-mRNA. The process of maturaƟon involves the removal of introns and the splicing together the exons. 16.) Define spliceosome: (2 points) A spliceosome is a complex molecular machine found in eukaryotic cells responsible removing introns from pre-mRNA during the process of RNA splicing. RNA splicing is a crucial step in the maturation of pre- mRNA into functional mRNA. 17.) In DNA what two nucleoƟdes are found at the start of each intron? (2 points) GU 18.) In DNA what two nucleoƟdes are found at the end of each intron? (2 points) AG Set-Up Your Genome Browser for the following and answer quesƟons #19-#21: D.melanogaster Aug 2014 chr4: 306,323-311,323 19.) What is the name of the gene you are looking at? (2 points) Chr4 (102B3) 20.) For isomer RA, what are the coordinates of the start codon? (2 points) 308,830 21.) What does a start codon do? (2 points) The start signal in our geneƟc code is made up of the leƩers A, T, and G, forming the code ATG. This specific sequence represents the amino acid Methionine and signals the cell to start reading the geneƟc instrucƟons. The cell reads these instrucƟons in groups of three, known as codons, to code for each amino acid and build the protein. Exon 3 Tats in site its introns Exons

Primers: 22.) DNA polymerase is the protein that adds new nucleoƟdes to the elongaƟng DNA strand during replicaƟon. In order for DNA polymerase to bind the template strand and add new nucleoƟdes, a free 3' hydroxyl group must be exposed to accept the first nucleoƟde. (1 point) Which of the following is created to provide a free 3' hydroxyl group, enabling the iniƟaƟon of DNA replicaƟon? Single- strand binding protein DNA polymerase II DNA primer ReplicaƟon fork RNA primer 23.) A piece of DNA has the following sequence: ATGGCATAC. What is the sequence of the complementary piece of DNA? (1 point) ATGGCATAC TACCGTATG CATACGGTA UACCGUAUG 24.) Given the DNA sequence TTACGTGCCA, determine which of the following best represents the complementary RNA sequence. (1 point) TTACGTGCCA UUACGUGCCA AATGCACGGT AAUGCACGGU Matching: #25-#32: (1 point each, 8 points total) a.) DNA polymerase b.) RNA primer c.) Ligase d.) Helicase e.) DNA primer f.) Primase g.) Topoisomerase h.) ss Binding proteins __E___ DNA polymerase elongates the new strand of DNA from this in the cell __F___ Enzyme that adds primers to the DNA strand __D___ Enzyme that separates DNA strand __B___ In a PCR experiment, the type of primer scienƟsts use __G___ Enzyme that relaxes supercoiling of DNA __H___ Added to DNA during S-phase of cell cycle to keep DNA strands apart __A___ Enzyme in charge of elongaƟng DNA __C___ Fills in the gaps of Okazaki fragments

Post lab 2

Related Documents