Experiment I_ Genotyping of ALDH2 gene by allele specific PCR - Laboratory Manual_

pdf

School

Hong Kong Baptist University, Hong Kong *

*We aren’t endorsed by this school

Course

2004

Subject

Biology

Date

Nov 24, 2024

Type

pdf

Pages

Uploaded by qwe48763

Page 1 BBMS1011 – Fundamental Biomedical Laboratory Techniques Experiment I: Genotyping of ALDH2 gene by allele specific PCR ALDH2 gene In mammals, the major metabolic pathway for the metabolism of ethanol involves alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH). Ethanol is first oxidized to acetaldehyde by alcohol dehydrogenase. Acetaldehyde is then converted to acetate by aldehyde dehydrogenase. In humans, liver mitochondrial aldehyde dehydrogenase-2 (ALDH2) is responsible for metabolising the acetaldehyde produced from ethanol into acetate. A decrease in ALDH2 activity results in a build-up of acetaldehyde upon alcohol consumption. Acetaldehyde causes redness (flushing) in the face and headache. (Conversion of ethanol to acetate. Source: http://www.medscape.com/) In human ALDH2 gene, a G to A substitution in exon 12 results in a glutamate to lysine substitution at amino acid position 504. This Glu504Lys substitution renders ALDH2 inactive. The G allele, designated as ALDH2*1, encodes active form of ALDH2 with glutamate at amino acid position 504. The A allele, designated as ALDH2*2, encodes the inactive form of ALDH2 with lysine at position 504. About 40% of Asians are ALDH2-deficient because they carry the ALDH2*2 allele (http://www.omim.org/entry/100650). Do I turn red when I drink? In this series of laboratory exercises, we will use the amplification refractory mutation system (ARMS) or allele- specific PCR to detect the G/A polymorphism in ALDH2. It is based on the principle that PCR primers mismatched at their 3 ¢ -OH end to the template DNA do not function as amplifiers under appropriate experimental conditions. Hence by deliberately introducing mismatches that destabilize primers at their 3 ¢ ends, PCR primers can be designed to distinguish between ALDH2*1 and ALDH2*2 alleles. Genotyping of the ALDH2 gene by allele-specific PCR consists of two separate PCR reactions using the same template (Figure 1). The first reaction contains a PCR primer (G) specific for the ALDH2*1 allele and cannot amplify the ALDH2*2 allele. The second reaction contains a PCR primer (A) specific for the ALDH2*2 allele and cannot amplify the ALDH2*1 allele.

Page 2 Figure 1: Allele specific PCR to genotype single nucleotide polymorphism in ALDH2. Primer G: ALDH2*1 allele specific primer; Primer A: ALDH2*2 allele specific primer; Primer F: common primer. TCAAATTACAGGGTCAACTGCTatgatgtgtttggagcccagtcaccctttggt ggctacaagatgtcggggagtggccgggagttgggcgagtacgggctgcaggca tacact[ g/a ]aagtgaaaactgtgagtgtgggacctgctgggggctcagggcctgtt ggggcttgagggtctgctggtggctcggagcctgctgggggattggggtctgtt gggggctcggggcctgccagaggttcaggacctgccggggactcagggcctgct ggaagttcaggacctgctggggatcagggcctgccagggatttagggtctgctg ggcgggccaccttttggcctctccctcatgcttgaggccatcagtgtttcctac taatttcccattttaagcctgagaagtgacaagagagggtaaagacccagcc Figure 2: Nucleotide sequences around the G/A polymorphic site in ALDH2. The sequences used to design the PCR primers ALDH2_F are in upper-case letters. The G/A polymorphic site is highlighted in bold.

Page 3 BBMS1011 – Fundamental Biomedical Laboratory Techniques Procedures 22 Jan 2024 A. Preparation of genomic DNA from buccal cells Zymo-spin IICR ( https://zymoresearch.eu/ ) columns with silica-based matrices are used to purify genomic DNA from buccal epithelial cells. Collect buccal epithelial cells from both the left and right cheeks. Brush the inside of the cheek with a buccal swab (approximately 20 brushes for each cheek), making sure to cover the entire area of the inner cheek. Put the swab into 500 µL of Genomic Lysis Buffer in a 1.5 mL microcentrifuge tube. Ensure that the swab head is fully submerged in the buffer solution. Stir by swirling the swab back and forth 20 times to transfer the cells from the swab to the lysis buffer. Discard the swab. Vortex 4-6 seconds and then let stand at room temperature for 10 minutes. Transfer the mixture to a Zymo-spin IICR Column in a collection tube. Centrifuge on a bench top microcentrifuge at 13,500 rpm for one minute. Make sure the rotor is balanced before you start the centrifuge. Discard the flow through. Add 200 µL of DNA Pre-Wash Buffer to the spin column. Centrifuge on a bench top microcentrifuge at 13,500 rpm for one minute. Discard the flow through. Add 500 µL of g-DNA Wash Buffer to the spin column. Centrifuge on a bench top microcentrifuge at 13,500 rpm for one minute. Discard the flow through and then spin again for an additional one minute. Transfer the spin column to a clean microcentrifuge tube. Add 50 µL of DNA Elution Buffer to the spin column. Incubate 2-5 minutes at room temperature and then centrifuge on a bench top microcentrifuge at 13,500 rpm for one minute to elute the genomic DNA. The eluted genomic DNA will be used for Part B . Label your sample with your assigned sample number. Keep your DNA samples on ice.

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

Page 4 B. Allele-specific PCR to genotype a single nucleotide polymorphism in ALDH2 Students work in your assigned groups of three (two in some cases). Each group will set up one master mix containing ALDH2*1 allele-specific primer, and one master mix containing ALDH2*2 allele- specific primer. NOTE: The master mixes are to be shared between all students in the group and should be enough for the experimental set-up. A. Master mix containing ALDH2*1 (G) allele-specific primer: H 2 O 206.5 µL 10 x PCR buffer (containing 15 mM MgCl 2 ) 35 µL 2 mM dNTP 35 µL Allele G primer mix (5 pmole/µL)† 14 µL GAPDH primer mix (5 pmole/µL)‡ 14 µL Taq polymerase (1 unit/µL) 10.5 µL Mix well by tapping the centrifuge tube briefly, followed by pulse centrifugation. B. Master mix containing ALDH2*2 (A) allele-specific primer: H 2 O 206.5 µL 10 x PCR buffer (containing 15 mM MgCl 2 ) 35 µL 2 mM dNTP 35 µL Allele A primer mix (5 pmole/µL)* 14 µL GAPDH primer mix (5 pmole/µL)‡ 14 µL Taq polymerase (1 unit/µL) 10.5 µL Mix well by tapping the centrifuge tube briefly, followed by pulse centrifugation. † Allele G primer mix contains ALDH2*1 (G) allele-specific primer and the common primer. * Allele A primer mix contains ALDH2*2 (A) allele-specific primer and the common primer. ‡ GAPDH primer mix contains forward and reverse primers for GAPDH.

Page 5 Each group will be given a DNA sample that is homozygous for the ALDH2*1 (G/G) allele and another DNA sample that is homozygous for the ALDH2*2 (A/A) allele. EACH student should also use their own genomic DNA sample with unknown genotype. Dispense 45 µL of the master mix into 0.2 mL thin-wall PCR strip tubes and add 5 µL of DNA sample as follows: Strip A Samples 1 2 3 4 Mastermix with ALDH2*1 (G) allele-specific primer 45 µL 45 µL Mastermix with ALDH2*2 (A) allele-specific primer 45 µL 45 µL DNA homozygous for ALDH2*1 (G/G) 5 µL 5 µL DNA homozygous for ALDH2*2 (A/A) 5 µL 5 µL Strip B Samples 1 2 3 4 5 6 Mastermix with ALDH2*1 (G) allele-specific primer 45 µL 45 µL 45 µL Mastermix with ALDH2*2 (A) allele-specific primer 45 µL 45 µL 45 µL Genomic DNA from Student A 5 µL 5 µL Genomic DNA from Student B 5 µL 5 µL Genomic DNA from Student C 5 µL 5 µL Label the PCR strips with your assigned group number. PCR conditions: 1 cycle: 95 ° C for 2 min 28 cycles: 95 ° C for 1 min (denaturation), 58 ° C for 45 sec (annealing), 72 ° C for 45 sec (extension) 1 cycle: 72 ° C for 5 min, 4°C until use

Page 6 29 Jan 2024 C. DNA agarose gel electrophoresis Each group (2 or 3 students) will prepare a 2% agarose gel for analysis of the PCR products: a) Add 1.2 gram agarose to 60 mL 1X TBE buffer in a conical flask b) Heat the solution on a hot plate or a microwave oven to dissolve the agarose c) Make sure that the agarose has completely dissolved d) Cool the gel solution to about 60°C e) Add 60 µL 0.625 mg/mL ethidium bromide solution f) Pour the agarose solution onto the gel caster g) Put in the comb and let the agarose solidify After PCR amplification, mix 15 µL of each of the PCR reaction mixture with 3 µL of 6X gel loading dye on a parafilm. Load the DNA/dye mixtures onto a 2% agarose gel. Also load 10 µL of 1-kb plus DNA ladder size marker (Figure 3) on a separate lane. Separate the DNA by electrophoresis at 100–120 volts for about 60–90 min. Visualize the gel under a UV transilluminator and take a photograph of the gel with the gel documentation system. Figure 3: 1-kb plus DNA ladder (http://www.lifetechnologies.com/order/catalog/product/10787026)

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

Page 7 D. Data analysis Based on the results of the allele specific PCR experiments, determine your genotype with respect to the ALDH2 locus. Pool class genotype data. Calculate the frequencies of the ALDH2*1 (G) and ALDH2*2 (A) alleles in this class. Use Chi-square goodness-of-fit test to determine whether the genotype frequencies are in Hardy- Weinberg equilibrium for this class. Use the Chi-square test of independence to determine whether the alcohol flush response is correlated with ALDH2 genotype. Questions The common primer used in this experiment is ALDH2_F as shown in Figure 2. Suggest possible allele-specific primer sequences, each 21 nucleotides in length, for ALDH2*1 allele and ALDH2*2 allele. Why are primers for GAPDH gene included in the PCR mix? Why are DNA with known ALDH2 genotype (homozygous G/G and homozygous A/A) included in the PCR setup? Some DNA polymerases have proof-reading activity. Explain why DNA polymerases that lack proof- reading activities should be used in this allele-specific PCR for genotyping. Why are individuals who are heterozygous (ALDH2*1/ALDH2*2) for the ALDH2 gene are deficient in ALDH2 activity even though a functional allele (ALDH2*1) is present? References Hayashida M, Iwao-Koizumi K, Murata S, Kinoshita K. (2009) Single-tube genotyping from a human hair root by direct PCR. Anal Sci. 25: 1487–1489. Hayashida M, Iwao-Koizumi K, Murata S, Yokoyama A, Kinoshita K. (2010) Genotyping of polymorphisms in alcohol and aldehyde dehydrogenase genes by direct application of PCR-RFLP on dried blood without DNA extraction. Anal Sci. 26: 503–505.

Experiment I_ Genotyping of ALDH2 gene by allele specific PCR - Laboratory Manual_

Related Documents