
Concept explainers
In a cell, the replication of DNA originates at origin of replication site or location in the genome. The biological process of producing two similar replicas of DNA from single original molecule of DNA is called as

Answer to Problem 1TQ
The DNA replication results in two DNA molecules, each of which has one old strand and one new strand.
Therefore, option (c) is correct.
Explanation of Solution
Justify the reasons for the correct statement:
The DNA is consists of a double helix structure with complementary strands. These complementary strands are separated during the replication. Then, each of the original molecules of DNA serves as a template for the generation of its counterpart. This process is termed as a semiconservative replication; as a result, the new helix will be formed from the original strand of DNA.
Option (c) is given as, “two DNA molecules, each of which has one old strand and one new strand”.
Hence, the option (c) is correct.
Justify the reasons for the incorrect statements:
Option (a) is given as, “two DNA molecules-one with two old strands, and one with two new strands”.
The DNA replication does not results in two old strands and two new strands. It results in two molecules of DNA with one old strand and one new strand. Hence, it is a wrong answer.
Option (b) is given as, “two DNA molecules, each of which has two new strands”.
The replication of DNA dose not results in two new strands but it contains one old strand and one new strand. Hence, it is a wrong answer.
Option (d) is given as, “none of the above”
The replication of the DNA results in two molecules of DNA one with new strand and other another with old strand. Thus, the given statement none of the above is inaccurate. Hence, it is a wrong answer.
Hence, options (a), (b), and (d) are incorrect.
The DNA replication is similar to all biological
Want to see more full solutions like this?
Chapter 9 Solutions
Biology Now with Physiology (Second Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





