Starting Out with Programming Logic and Design (4th Edition)
4th Edition
ISBN: 9780133985078
Author: Tony Gaddis
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Expert Solution & Answer
Chapter 9, Problem 1AW
Explanation of Solution
Module swap(Real Ref x, Real Ref y)
Declare Real temp
Set temp = x
Set x = y
Set y = temp
End Module
Explanation for above given module:
The above swap module accepts two real arguments “x” and “y”...
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Task using C language
One common way of verifying if the data integrity of a file was preserved during a copy or transmission is to verify if the checksum matches. The checksum is a small piece of data computed from the original data. Your task is to compute a recursive function that maps an integer into a single digit to be used as checksum. Given an input integer in the range from 0 to 1012, the checksum is the sum of the digits of the input number. While the resulting sum has multiple digits, the checksum will be the sum of its digits instead. For instance:
if the input is 34, the checksum is 7 (3+4);
if the input is 99, the sum of its digits is 18 (9+9), so the checksum is 9 (1+8);
if the input is 99999999999, the sum of its digits is 99 (9+9+9+9+9+9+9+9+9+9+9), whose sum of digits is 18 (9+9), so the checksum is 9 (1+8).
Requirements
Follow the format of the examples below.
Make sure your variables and parameters have the correct data types.
You must implement a recursive…
In C++, When an array is passed to a function as a pointer, the function doesn't know the size of the array. List 3 ways to handle this problem.
In C Programming:
Write a function inputAllCourses() which receives an array of course pointers and the array’s size, then allows the user to input all courses in the array by calling inputCourse()
Chapter 9 Solutions
Starting Out with Programming Logic and Design (4th Edition)
Ch. 9.3 - Which of the sorting algorithms discussed makes...Ch. 9.3 - Prob. 9.2CPCh. 9.3 - Prob. 9.3CPCh. 9.4 - Prob. 9.4CPCh. 9.4 - On average, with an array of 1,000 elements, how...Ch. 9.4 - Prob. 9.6CPCh. 9 - Prob. 1MCCh. 9 - Prob. 2MCCh. 9 - Prob. 3MCCh. 9 - Prob. 4MC
Ch. 9 - Prob. 5MCCh. 9 - Prob. 6MCCh. 9 - Prob. 7MCCh. 9 - Prob. 8MCCh. 9 - Prob. 9MCCh. 9 - Prob. 10MCCh. 9 - Prob. 1TFCh. 9 - Prob. 2TFCh. 9 - Prob. 3TFCh. 9 - Prob. 4TFCh. 9 - Prob. 5TFCh. 9 - Prob. 1AWCh. 9 - Prob. 2AWCh. 9 - Prob. 3AWCh. 9 - What algorithm does the following pseudocode...Ch. 9 - Prob. 1SACh. 9 - Prob. 2SACh. 9 - Prob. 3SACh. 9 - Prob. 4SACh. 9 - Prob. 5SACh. 9 - Why is the selection sort more efficient than the...Ch. 9 - Prob. 7SACh. 9 - Prob. 8SACh. 9 - Assume the following main module is in a program...Ch. 9 - Prob. 1PECh. 9 - Sorted Names Design a program that allows the user...Ch. 9 - Rainfall Program Modification Recall that...Ch. 9 - Name Search Modify the Sorted Names program that...Ch. 9 - Charge Account Validation Recall that Programming...Ch. 9 - Prob. 7PECh. 9 - Sorting Benchmarks Modify the modules presented in...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- Using either pseudocode of C++ code, write a function that takes three parameters and performs a sequential search. The first parameter is an array of integers. The second parameter is an integer representing the size of the array. The third parameter takes the value to be search form. The function should return the subscripts at which the value is found or -1 is the array does not contain the search term.arrow_forwardpointers as Arguments:In the C programming language there is no pass-by-reference syntax to passa variable by reference to a function. Instead a variable is passed by pointer(just to be confusing, sometimes passing by pointer is referred to as pass byreference). This Practice Program asks you to do the same thing as C.Here is the header for a function that takes as input a pointer to an integer:1. void addOne (int ∗ptrNum )Complete the function so it adds one to the integer referenced by ptrNum.Write a main function where an integer variable is defined, give it an initialvalue, call addOne, and output the variable. It should be incremented by 1.arrow_forwardC Program Functions using Pointers Create a function modify that accepts an integer and divides the integer by 2 if it is even. If the integer is odd, add one and divide it by 2. The function does not return anything. In the main function, write a program that asks for an integer input and call the modify function by passing in the reference of that variable as a parameter. An initial code is provided for you. Just fill in the blanks. Input 1. One line containing an integer input Output Enter a number: 5 Before: 5 After: 3arrow_forward
- Define the term " null pointer " .arrow_forwardC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forwardIn C programming: Write a function printAllCourses() which receives an array of course pointers and the array’s size, then prints all courses in the array by calling printCourseRow()arrow_forward
- File Handling with Multi Dimension Array: C++ Language: Write a c++ program to read the data from the file into array and Calculate the rows and columns in the multi dimension. Take any problem of your choose.arrow_forwardparameter list can also contain the data type of the output of function : true/false a function declared int addition (int a and b) is capable of returning one value back to the main loop : true/false main () is a void function: true / false the address returned by the reference pointer is always the same regardless of operating system: true/false a function declares as int addition (int a, int b) has a and b as output arguments : true/ falsearrow_forwardUsing C++ Programming language: Assume you want a function which expects as parameters an array of doubles and the size of the array. Write the function header that accepts these parameters but is defined in such a way that the array cannot be modified in the function. You can use your own variable names for the parameters.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Systems ArchitectureComputer ScienceISBN:9781305080195Author:Stephen D. BurdPublisher:Cengage Learning
Systems Architecture
Computer Science
ISBN:9781305080195
Author:Stephen D. Burd
Publisher:Cengage Learning