Concept explainers
a.
To determine:
The term that describes “protein-coding segment”.

Answer to Problem 16SA
Correct answer:
Protein-coding segment: Exon.
Explanation of Solution
b.
To determine:
The term that describes “transcription begins here”.

Answer to Problem 16SA
Correct answer:
Transcription begins here: Promoter.
Explanation of Solution
c.
To determine:
The term that describes “read as base triplets”.

Answer to Problem 16SA
Correct answer:
Read as base triplets: Genetic message.
Explanation of Solution
d.
To determine:
The term that describes “removed before translation”.

Answer to Problem 16SA
Correct answer:
Removed before translation: Intron.
Explanation of Solution
e.
To determine:
The term that describes “occurs only in groups”.

Answer to Problem 16SA
Correct answer:
Occurs only in groups: Polysome.
Explanation of Solution
The ribosome is the cell organelle that has the capability to synthesize proteins. The process of conversion of
f.
To determine:
The term that describes “64 codons”.

Answer to Problem 16SA
Correct answer:
64 codons: Genetic code.
Explanation of Solution
A collection of three bases that has the capability to code for a particular amino acid is called codon. Codons are present in the
g.
To determine:
The term that describes “destroy ribosomes”.

Answer to Problem 16SA
Correct answer:
Destroy ribosomes:
Explanation of Solution
h.
To determine:
The term that describes “often causes a frameshift”.

Answer to Problem 16SA
Correct answer:
Often causes a frameshift: Deletion.
Explanation of Solution
Mutation is defined as the changes in the genetic material of an organism. There are different types of mutation, such as frameshift mutation and so on. Generally, mutation occurs either due to insertion or deletion in the genetic material. Frameshift is caused due to the deletion of a
i.
To determine:
The term that describes “enzymatic

Answer to Problem 16SA
Correct answer:
Enzymatic
Explanation of Solution
Every organism present in nature contains genetic material. There are two types of genetic material. These are
j.
To determine:
The term that describes “binds to codon

Answer to Problem 16SA
Correct answer:
Binds to codon: Anticodon.
Explanation of Solution
The
Want to see more full solutions like this?
Chapter 9 Solutions
BIOLOGY-CONCEPTS+APP.CHAP 1-15>CUSTOM<
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning





