Chapter 8, Problem 7P

Summary Introduction

To determine: Whether the melting temperature will be higher or lower if an RNA duplex oligonucleotide with sequence $\text{UAAUACGACUCACUAUAGGG}$ is constructed.

Concept introduction:

At higher melting temperature DNA undergoes denaturation as doubles strands are broken down into single strands. The melting temperature of DNA molecules depend on the content of GC, length of DNA, nucleotide sequences, and stability of DNA molecule. Stability of DNA is determined by interactions between bases, between bases and water and base stacking interactions within adjacent bases.