GENETICS(LL)-W/CONNECT >CUSTOM<
GENETICS(LL)-W/CONNECT >CUSTOM<
6th Edition
ISBN: 9781260571561
Author: HARTWELL
Publisher: MCG CUSTOM
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 7, Problem 1P

The following is a list of mutational changes. For each of the specific mutations described, indicate which of the terms in the right-hand column applies, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column.

1. an A-T base pair in the wild-type gene is changed to a G-C pair a. transition
2. an A-T base pair is changed to a T-A pair b. base substitution
3. the sequence AAGCTTATCG is changed to AAGCTATCG c. transversion
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG d. deletion
5. the sequence AACGTTATCG is changed to AATGTTATCG e. insertion
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG f. deamination
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG g. X-ray irradiation
h. intercalator
i. slipped mispairing
Expert Solution
Check Mark
Summary Introduction

1.

To determine:

The item that describes “an A-T base pair in the wild-type gene is changed to a G-C pair.”

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When purines and pyrimidines are exchanged with each other, the process is called transition.

Answer to Problem 1P

Correct answer:

An A-T base pair in the wild-type gene is changed to a G-C pair: transition and base substitution.

Explanation of Solution

In the given mutation, A-T base pair is exchanged with a G-C base pair so it can be a base substitution. This can also be a transition mutation because adenine is a purine which is interchanged with another purine that is guanine. Thymine replaced the cytosine, and both are also pyrimidines. Thus, this condition can be a base substitution mutation or a transition mutation.

Expert Solution
Check Mark
Summary Introduction

2.

To determine:

The item that describes “an A-T base pair is changed to a T-A pair”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one purine is replaced by pyrimidine in a pair of two bases, the resulting process is called transversion.

Answer to Problem 1P

Correct answer:

an A-T base pair is changed to a T-A pair: base substitution and transversion.

Explanation of Solution

In the given mutation, a base pair ‘A-T’ can be changed to a ‘T-A’ base-pair so the replacement of one purine with pyrimidine can be observed. Thus, the mutation for concerting A-T into T-A can be a transversion. The substitution of A by T is taking place so, it can also be a base substitution mutation.

Expert Solution
Check Mark
Summary Introduction

3.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

In this particular case, the exposure of X-rays is responsible for deletion mutation from the wild type sequence.

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTATCG: deletion and X-ray irradiation.

Explanation of Solution

If both, wild type and mutated sequence are observed that it can be seen that there is a deletion of nitrogenous base T from wild type sequence. The exposure to X-ray irradiation may be responsible for deletion mutation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

Expert Solution
Check Mark
Summary Introduction

4.

To determine:

The item that describes “the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are added to a specific sequence of nucleotides, then the process of insertion takes place.

Answer to Problem 1P

Correct answer:

The sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG: insertion and intercalator.

Explanation of Solution

Insertion is a mutation in which a nitrogenous base or a group of the nitrogenous bases are added to a sequence. In the given mutation, a thymine residue is added to the wild type sequence for mutation. Thus, the kind of mutation is an insertion, and it can result from the introduction of some chemical mutagens like ethidium bromide. These chemical mutagens are intercalated with sequence and are known as intercalators. Thus, the correct match for the given mutation is insertion and intercalator.

Expert Solution
Check Mark
Summary Introduction

5.

To determine:

The item that describes “the sequence AACGTTATCG is changed to AATGTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Transition is the change of one purine to another purine or one pyrimidine to another pyrimidine.

Answer to Problem 1P

Correct answer:

the sequence AACGTTATCG is changed to AATGTTATCG: base substitution, transition, and deamination.

Explanation of Solution

In the given mutation, base T is exchanged with base C so it can be a base substitution. This can also be a transition mutation because cytosine is a pyrimidine which is interchanged with another pyrimidine that is thymine. Deamination can also be noticed in the given mutation because the conversion of a methylated C to T is taking place. Thus, the correct match for the given mutation is a substitution, transition, and deamination.

Expert Solution
Check Mark
Summary Introduction

6.

To determine:

The item that describes “the sequence AACGTCACACACATCG is changed to AACGTCACATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Crossing over is the process of exchange of genetic material between the sister chromatids at chiasmata.

Answer to Problem 1P

Correct answer:

The sequence AACGTCACACACATCG is changed to AACGTCACATCG: deletion and crossing over.

Explanation of Solution

In the given mutation, it can be noticed that a segment CACACACA has been lost from wild type sequence, so it is representing deletion. A segment can be removed from the wild type gene during the process of crossing over. Thus, the correct match for the given mutation is deletion and crossing over.

Expert Solution
Check Mark
Summary Introduction

7.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are removed from the nucleotide sequence, then the process is called deletion.

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTTTATCG: deletion and X-ray irradiation.

Explanation of Solution

Observation of wild type and mutated sequence can lead to a conclusion that there is a deletion of nitrogenous base T from wild type sequence. Deletion mutation may happen to because of exposure to X-ray irradiation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
Analyze the effectiveness of the a drug treatment program based on the needs of 18-65 year olds who are in need of treatment by critically describing 4 things in the program is doing effectively and 4 things the program needs some improvement.
I have the first half finished... just need the bottom half.
13. Practice Calculations: 3 colonies were suspended in the following dilution series and then a viable plate count and microscope count was performed. Calculate IDF's, TDF's and then calculate the CFU/mL in each tube by both methods. Finally calculate the cells in 1 colony by both methods. Show all of your calculations in the space provided on the following pages. 3 colonies 56 cells 10 μL 10 μL 100 μL 500 με m OS A B D 5.0 mL 990 με 990 με 900 με 500 μL EN 2 100 με 100 μL 118 colonies 12 colonies

Chapter 7 Solutions

GENETICS(LL)-W/CONNECT >CUSTOM<

Ch. 7 - Like the yellow Labrador retrievers featured in...Ch. 7 - Remember that Balancer chromosomes prevent the...Ch. 7 - Figure 7.14 shows examples of base substitutions...Ch. 7 - Figure 7.14a shows the mutagen 5-bromouracil 5-BU,...Ch. 7 - So-called two-way mutagens can induce both a...Ch. 7 - In 1967, J. B. Jenkins treated wild-type male...Ch. 7 - When a particular mutagen identified by the Ames...Ch. 7 - Prob. 18PCh. 7 - The Ames test uses the reversion rate His- to His...Ch. 7 - The mutant FMR-1 allele that causes fragile X...Ch. 7 - The physicist Stephen Hawking, famous for his...Ch. 7 - Aflatoxin B1 is a highly mutagenic and...Ch. 7 - In human DNA, 70 of cytosine residues that are...Ch. 7 - Bromodeoxyuridine BrdU is a synthetic nucleoside...Ch. 7 - Albinism in animals is caused by recessive...Ch. 7 - a. In Figure 7.22b, what can you say about the...Ch. 7 - Imagine that you caught a female albino mouse in...Ch. 7 - Plant breeders studying genes influencing leaf...Ch. 7 - In humans, albinism is normally inherited in an...Ch. 7 - a. Seymour Benzers fine structure analysis of the...Ch. 7 - a. You have a test tube containing 5 ml of a...Ch. 7 - Prob. 32PCh. 7 - The rosy ry gene of Drosophila encodes an enzyme...Ch. 7 - Nine rII- mutants of bacteriophage T4 were used in...Ch. 7 - In a haploid yeast strain, eight recessive...Ch. 7 - In Problem 24, you learned that Bloom syndrome is...Ch. 7 - The pathway for arginine biosynthesis in...Ch. 7 - In corn snakes, the wild-type color is brown. One...Ch. 7 - In a certain species of flowering plants with a...Ch. 7 - The intermediates A, B, C, D, E, and F all occur...Ch. 7 - In each of the following cross schemes, two...Ch. 7 - Prob. 42PCh. 7 - The following complementing E. coli mutants were...Ch. 7 - In 1952, an article in the British Medical Journal...Ch. 7 - Mutations in an autosomal gene in humans cause a...Ch. 7 - Antibodies were made that recognize six proteins...Ch. 7 - Prob. 47PCh. 7 - Prob. 48PCh. 7 - In addition to the predominant adult hemoglobin,...Ch. 7 - Most mammals, including New World primates such as...Ch. 7 - Humans are normally trichromats; we have three...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY