
EBK GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260041255
Author: HARTWELL
Publisher: MCGRAW HILL BOOK COMPANY
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 6, Problem 28P
A DNA synthesizer is a machine that uses automated chemical synthesis to generate short, single strands of DNA of any given sequence. You have used the machine to synthesize the following three DNA molecules:
(DNA 1) | 5′ CTACTACGGATCGGG 3′ |
(DNA 2) | 5′ CCAGTCCCGATCCGT 3′ |
(DNA 3) | 5′ AGTAGCCAGTGGGGAAAAACCCCACTGG 3 |
Now you add the DNA molecules either singly or in combination to reaction tubes containing DNA polymerase, dATP, dCTP, dGTP, and dTTP in a buffered solution that allows DNA polymerase to function. For each of the reaction tubes, indicate whether DNA polymerase will synthesize any new DNA molecules, and if so, write the sequence(s) of any such DNAs.
a. | DNA 1 plus DNA 3 |
b. | DNA 2 plus DNA 3 |
c. | DNA 1 plus DNA 2 |
d. | DNA 3 only |
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Ch.23
How is Salmonella able to cross from the intestines into the blood?
A. it is so small that it can squeeze between intestinal cells
B. it secretes a toxin that induces its uptake into intestinal epithelial cells
C. it secretes enzymes that create perforations in the intestine
D. it can get into the blood only if the bacteria are deposited directly there, that is, through a puncture
—
Which virus is associated with liver cancer?
A. hepatitis A
B. hepatitis B
C. hepatitis C
D. both hepatitis B and C
—
explain your answer thoroughly
Ch.21
What causes patients infected with the yellow fever virus to turn yellow (jaundice)?
A. low blood pressure and anemia
B. excess leukocytes
C. alteration of skin pigments
D. liver damage in final stage of disease
—
What is the advantage for malarial parasites to grow and replicate in red blood cells?
A. able to spread quickly
B. able to avoid immune detection
C. low oxygen environment for growth
D. cooler area of the body for growth
—
Which microbe does not live part of its lifecycle outside humans?
A. Toxoplasma gondii
B. Cytomegalovirus
C. Francisella tularensis
D. Plasmodium falciparum
—
explain your answer thoroughly
Ch.22
Streptococcus pneumoniae has a capsule to protect it from killing by alveolar macrophages, which kill bacteria by…
A. cytokines
B. antibodies
C. complement
D. phagocytosis
—
What fact about the influenza virus allows the dramatic antigenic shift that generates novel strains?
A. very large size
B. enveloped
C. segmented genome
D. over 100 genes
—
explain your answer thoroughly
Chapter 6 Solutions
EBK GENETICS: FROM GENES TO GENOMES
Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - During bacterial transformation, DNA that enters a...Ch. 6 - Nitrogen and carbon are more abundant in proteins...Ch. 6 - If 30 of the bases in human DNA are A, a what...Ch. 6 - Which of the following statements are true about...Ch. 6 - Imagine you have three test tubes containing...Ch. 6 - What information about the structure of DNA was...Ch. 6 - A portion of one DNA strand of the human gene...Ch. 6 - When a double-stranded DNA molecule is exposed to...
Ch. 6 - A particular virus with DNA as its genetic...Ch. 6 - The underlying structure of DNA is very simple,...Ch. 6 - Prob. 13PCh. 6 - Bacterial transformation and bacteriophage...Ch. 6 - The CAP protein is shown bound to DNA in Fig....Ch. 6 - In Meselson and Stahls density shift experiments...Ch. 6 - When Meselson and Stahl grew E. coli in 15N medium...Ch. 6 - If you expose human tissue culture cells for...Ch. 6 - Draw a replication bubble with both replication...Ch. 6 - a. Do any strands of nucleic acid exist in nature...Ch. 6 - As Fig. 6.21 shows, DNA polymerase cleaves the...Ch. 6 - The bases of one of the strands of DNA in a region...Ch. 6 - Replicating structures in DNA can be observed in...Ch. 6 - Indicate the role of each of the following in DNA...Ch. 6 - Draw a diagram of replication that is occurring at...Ch. 6 - Figure 6.18 depicts Watson and Cricks initial...Ch. 6 - Researchers have discovered that during...Ch. 6 - A DNA synthesizer is a machine that uses automated...Ch. 6 - Bacterial cells were coinfected with two types of...Ch. 6 - A yeast strain with a mutant spo11- allele has...Ch. 6 - Imagine that you have done a cross between two...Ch. 6 - The Neurospora octad shown came from a cross...Ch. 6 - From a cross between e f g and e f g strains of...Ch. 6 - In Step 6 of Fig. 6.27, the resolvase enzyme...Ch. 6 - Figure 6.31shows four potential outcomes of...Ch. 6 - Each of the substrates for site-specific...Ch. 6 - Prob. 37PCh. 6 - Suppose that you could inject a wild-type mouse...Ch. 6 - C31 is a type of bacteriophage that infects...Ch. 6 - Cre is a recombinase enzyme encoded by a gene in...Ch. 6 - Like Cre/loxP recombination, site-specific...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is this?arrow_forwardMolecular Biology A-C components of the question are corresponding to attached image labeled 1. D component of the question is corresponding to attached image labeled 2. For a eukaryotic mRNA, the sequences is as follows where AUGrepresents the start codon, the yellow is the Kozak sequence and (XXX) just represents any codonfor an amino acid (no stop codons here). G-cap and polyA tail are not shown A. How long is the peptide produced?B. What is the function (a sentence) of the UAA highlighted in blue?C. If the sequence highlighted in blue were changed from UAA to UAG, how would that affecttranslation? D. (1) The sequence highlighted in yellow above is moved to a new position indicated below. Howwould that affect translation? (2) How long would be the protein produced from this new mRNA? Thank youarrow_forwardMolecular Biology Question Explain why the cell doesn’t need 61 tRNAs (one for each codon). Please help. Thank youarrow_forward
- Molecular Biology You discover a disease causing mutation (indicated by the arrow) that alters splicing of its mRNA. This mutation (a base substitution in the splicing sequence) eliminates a 3’ splice site resulting in the inclusion of the second intron (I2) in the final mRNA. We are going to pretend that this intron is short having only 15 nucleotides (most introns are much longer so this is just to make things simple) with the following sequence shown below in bold. The ( ) indicate the reading frames in the exons; the included intron 2 sequences are in bold. A. Would you expected this change to be harmful? ExplainB. If you were to do gene therapy to fix this problem, briefly explain what type of gene therapy youwould use to correct this. Please help. Thank youarrow_forwardMolecular Biology Question Please help. Thank you Explain what is meant by the term “defective virus.” Explain how a defective virus is able to replicate.arrow_forwardMolecular Biology Explain why changing the codon GGG to GGA should not be harmful. Please help . Thank youarrow_forward
- Stage Percent Time in Hours Interphase .60 14.4 Prophase .20 4.8 Metaphase .10 2.4 Anaphase .06 1.44 Telophase .03 .72 Cytukinesis .01 .24 Can you summarize the results in the chart and explain which phases are faster and why the slower ones are slow?arrow_forwardCan you circle a cell in the different stages of mitosis? 1.prophase 2.metaphase 3.anaphase 4.telophase 5.cytokinesisarrow_forwardWhich microbe does not live part of its lifecycle outside humans? A. Toxoplasma gondii B. Cytomegalovirus C. Francisella tularensis D. Plasmodium falciparum explain your answer thoroughly.arrow_forward
- Select all of the following that the ablation (knockout) or ectopoic expression (gain of function) of Hox can contribute to. Another set of wings in the fruit fly, duplication of fingernails, ectopic ears in mice, excess feathers in duck/quail chimeras, and homeosis of segment 2 to jaw in Hox2a mutantsarrow_forwardSelect all of the following that changes in the MC1R gene can lead to: Changes in spots/stripes in lizards, changes in coat coloration in mice, ectopic ear formation in Siberian hamsters, and red hair in humansarrow_forwardPleiotropic genes are genes that (blank) Cause a swapping of organs/structures, are the result of duplicated sets of chromosomes, never produce protein products, and have more than one purpose/functionarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License