
Concept explainers
Source-sink metapopulations are distinct from other types of metapopulations because
a. exchange of individuals only occurs in the former.
b.
c. populations never go extinct in the former.
d. all populations eventually go extinct in the former.

Introduction:
When the network of different populations exchanges its individuals, it is known as metapopulation. This happens because of the distribution of suitable and unsuitable habitat. If there is difference in the habitats of long term populations which affect its growth and decline is known as source-sink metapopulation.
Answer to Problem 1U
Correct answer:
The decline in the population is also considered in the source-sink metapopulation. Therefore, option b. is correct.
Explanation of Solution
Reason for the correct statement:
In source-sink population, there is continuous sending of dispersers from better areas that bolster the population in the areas that are poorer. The better areas or habitats act as the source and the poorer areas or habitats act as sink. If there is no continuous shifting of individuals, then the sink population increases and shows a negative growth and may lead to extinction.
Option b. is given as“populations with negative growth rates are a part of the former”.
As, “Source-sink metapopulations are distinct from the types of metapopulations because populations with negative growth rates are a part of the former”, is the right answer.
Hence, the option b. is correct.
Reasons for the incorrect statements:
Option a. is given as “exchange of individuals only occurs in the former”.
The exchange of individuals occurs in both metapopulations as well as in the source-sink populations. So, it is a wrong answer.
Option c. is given as “populations never go extinct in the former”.
In sink-source metapopulations, if the continuous replenishment is absent, then the poor habitat show negative growth rates that may lead to the extinction of species. So, it is a wrong answer.
Option d. is given as “all populations eventually go extinct in the former”.
Not all the populations show negative growth; only a part of population of poorer habitat show negative growth and extinct. So, it is a wrong answer.
Hence, options a., c., and d. are incorrect.
The metapopulations involves the migration of individuals from one group to another group in a population. In source-sink population, one of the populations with poor habitat may show negative growth.
Want to see more full solutions like this?
Chapter 55 Solutions
Biology
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning




