
Concept explainers
The movement of matter is _______________ in ecosystems, and the movement of energy is _________________. (a) linear; linear (b) linear; cyclic (c) cyclic; cyclic (d) cyclic; linear (e) cyclic; linear or cyclic

Introduction: Energy comes to the earth from the sun in the form of light. The organisms use the energy source for growth, transfer of energy, oxygen production, and recycling of water and minerals with a great efficiency. The interactions among the organisms living together in a particular place and interaction among these organisms with their abiotic environment are known as ecosystem.
Answer to Problem 1TYU
Correct answer: The movement of matter is cyclic in ecosystems, and the movement of energy is linear. Hence, the correct answer is option (d).
Explanation of Solution
Reason for the correct answer:
Option (d) is given as “cyclic; linear”.
The movement of matter through an ecosystem occurs in a cyclic manner. Matter moves through the ecosystem in numerous cycles from one part to another part and from one organism to another organism and again back to the environment. This cyclic process is also called as biogeochemical cycles. The energy from producers is transferred to the consumers and then to the decomposers. The energy flow through an ecosystem occurs in a linear manner from the sun to the producer, then to the consumer and finally to decomposers. Some of the energy while transferring from one trophic level to another trophic level gets converted to heat. Thus, total energy that is consumed by the producer cannot be transferred completely to the next trophic level. In each trophic level, some amount of energy is converted to heat and comes back to the atmosphere.
Hence, the correct answer is option (d).
Reasons for incorrect answers:
Option (a) is given as “linear; linear”.
The movement of matter does not occur through a linear process because matter moves in a cyclic manner that starts from the environment, enters the ecosystem, and again back to the environment. The movement of energy occurs in a linear manner.
Hence, option (a) is incorrect.
Option (b) is given as “linear; cyclic”.
The movement of matter does not occur through linear process because matter moves in a cyclic manner that starts from the environment, enters the ecosystem, and again back to the environment. The flow of energy occurs in the ecosystem in a linear manner; it starts from the sun then to producers, and then to consumers and decomposers.
Hence, option (b) is incorrect.
Option (c) is given as “cyclic; cyclic”.
The movement matter is cyclic, and movement of energy is linear. The flow of energy occurs in the ecosystem in a linear manner; it starts from the sun to producers and then to consumers.
Hence, option (c) is incorrect.
Option (e) is given as “cyclic; linear or cyclic”.
The movement of matter is cyclic, and movement of energy is linear.
Hence, option (e) is incorrect.
Hence, options (a), (b), (c), and (e) are incorrect.
The movement of matter occurs through a cyclic manner in ecosystems, and the movement of energy occurs through a linear manner.
Want to see more full solutions like this?
Chapter 55 Solutions
Biology (MindTap Course List)
Additional Science Textbook Solutions
Biological Science (6th Edition)
Chemistry: Atoms First
Microbiology Fundamentals: A Clinical Approach
Human Physiology: An Integrated Approach (8th Edition)
Genetics: From Genes to Genomes
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning



