
Concept explainers
The fluid mosaic model of the membrane describes the membrane as
a. containing a significant quantity of water in the interior.
b. composed of fluid phospholipids on the outside and protein on the inside.
c. composed of protein on the outside and fluid phospholipids on the inside.
d. made of proteins and lipids that can freely move.

Introduction:
The fluid mosaic model of plasma membrane was proposed by Singer and Nicolson. They stated that plasma membrane is a semipermeable membrane that allows only selective particles to go in and out of the cell. It is made of phospholipids and proteins, which are embedded within the lipid bilayer.
Answer to Problem 1U
Correct answer:
The fluid mosaic model describes the plasma membrane as a mosaic of proteins floating in a layer of lipids. Therefore, option d is correct.
Explanation of Solution
Reason for the correct statement
The fluid mosaic model explains that proteins are embedded within the lipid bilayer. The lipid bilayer provides fluidity and elasticity to the membrane, and it consists of transmembrane proteins floating in the lipid bilayer. It helps in transportation and communication across the membrane. The lipid bilayer also contains interior proteins that help to maintain the shape of the membrane.
Option d is given as “made of proteins and lipids that can move freely.”
As “the plasma membrane is made of phospholipids bilayer in which proteins are embedded and provides flexibility as well as helps in transportation and communication across the membrane,” option d is the right answer.
Reasons for the incorrect statements:
Option a is given as “containing a significant quantity of water in the interior.”
The plasma membrane is made of a lipid bilayer and proteins that provide stability to the membrane. So, it is a wrong answer.
Option b is given as “composed of fluid phospholipids inside and proteins outside.”
The plasma membrane is composed of phospholipids with the hydrophobic tails inside and hydrophilic heads outside, whereas intrinsic proteins are embedded in the lipid bilayer and extrinsic proteins are present outside the lipid bilayer. So, it is a wrong answer.
Option c is given as “composed of proteins on the outside and fluid phospholipids on the inside.”
The lipid bilayer is arranged in a specific manner such as its hydrophobic tail is present inside and hydrophilic head is present outside. Similarly, there are two types of proteins present in the plasma membrane: intrinsic proteins which are present inside the lipid bilayer and extrinsic proteins, which are present outside the lipid bilayer. So, it is a wrong answer.
Hence, options a, b, and c are incorrect.
Plasma membrane is called semipermeable membrane as it allows only selective particles to go in and out of the cell and it helps in protection of cell from several injuries. It prevents infections by blocking the entry of disease-causing microorganisms.
Want to see more full solutions like this?
Chapter 5 Solutions
Biology
- Don't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forwardBiology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forward
- Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forward
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning





