
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 4.5, Problem 28CYP
Summary Introduction
Introduction:
Spirillum are curviform or spiral-shaped cells while spirochete are periplasmic flagella that have spring-like appearance.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 4 Solutions
Foundations in Microbiology
Ch. 4.1 - Describe the fundamental characteristics of cells.Ch. 4.1 - Identify the primary properties that define life...Ch. 4.1 - Prob. 1CYPCh. 4.1 - Name several general characteristics that could be...Ch. 4.2 - Describe the generalized anatomy of bacterial...Ch. 4.2 - Prob. 4ELOCh. 4.2 - Describe the structure and position of bacterial...Ch. 4.2 - Explain how flagella influence motility and motile...Ch. 4.2 - Prob. 7ELOCh. 4.2 - Define glycocalyx, and describe its different...
Ch. 4.2 - What other microbial groups besides bacteria have...Ch. 4.2 - Prob. 4CYPCh. 4.2 - How does the flagellum dictate the behavior of a...Ch. 4.2 - Differentiate between the structure and functions...Ch. 4.2 - Prob. 7CYPCh. 4.2 - Prob. 8CYPCh. 4.2 - Prob. 9CYPCh. 4.2 - Explain how the bacterial glycocalyx and certain...Ch. 4.3 - Prob. 9ELOCh. 4.3 - Outline the structure and functions of cell walls,...Ch. 4.3 - Contrast the major structure of gram-positive and...Ch. 4.3 - Prob. 12ELOCh. 4.3 - Relate the characteristics of other types of cell...Ch. 4.3 - Prob. 14ELOCh. 4.3 - Prob. 11CYPCh. 4.3 - Prob. 12CYPCh. 4.3 - Prob. 13CYPCh. 4.3 - How does the precise structure of the cell walls...Ch. 4.3 - Prob. 15CYPCh. 4.3 - Prob. 16CYPCh. 4.3 - Describe the medical impact of the cell walls of...Ch. 4.3 - Prob. 18CYPCh. 4.3 - Prob. 19CYPCh. 4.4 - Prob. 15ELOCh. 4.4 - Prob. 16ELOCh. 4.4 - Characterize the bacterial ribosomes and...Ch. 4.4 - Prob. 18ELOCh. 4.4 - Prob. 19ELOCh. 4.4 - Discuss the resistance and significance of...Ch. 4.4 - Prob. 20CYPCh. 4.4 - What is unique about the structure of bacterial...Ch. 4.4 - Prob. 22CYPCh. 4.4 - Prob. 23CYPCh. 4.4 - Describe the way endospores are formed, their...Ch. 4.4 - Prob. 25CYPCh. 4.4 - Why are spores so difficult to destroy?Ch. 4.5 - Describe the shapes of bacteria and their possible...Ch. 4.5 - Prob. 22ELOCh. 4.5 - Outline the size ranges among bacteria and in...Ch. 4.5 - Prob. 27CYPCh. 4.5 - Prob. 28CYPCh. 4.5 - What are vibrios and coccobacilli?Ch. 4.5 - Prob. 30CYPCh. 4.5 - Prob. 31CYPCh. 4.5 - Prob. 32CYPCh. 4.6 - Prob. 24ELOCh. 4.6 - Prob. 25ELOCh. 4.6 - Outline a basic system of bacterial taxonomy.Ch. 4.6 - Explain the species and subspecies levels for...Ch. 4.6 - Prob. 33CYPCh. 4.6 - Prob. 34CYPCh. 4.6 - Prob. 35CYPCh. 4.7 - Differentiate various groups of photosynthetic...Ch. 4.7 - Characterize the types of obligate intracellular...Ch. 4.7 - Prob. 30ELOCh. 4.7 - Prob. 31ELOCh. 4.7 - Prob. 32ELOCh. 4.7 - Prob. 36CYPCh. 4.7 - Name two main groups of obligate intracellular...Ch. 4.7 - Explain the characteristics of archaea that...Ch. 4.7 - Prob. 39CYPCh. 4.7 - Describe the three major archaeal lifestyles and...Ch. 4.L1 - Prob. 1MCQCh. 4.L1 - Viruses are not considered living things because...Ch. 4.L1 - Prob. 3MCQCh. 4.L1 - Prob. 4MCQCh. 4.L1 - Pili are appendages in _________ bacteria that...Ch. 4.L1 - Prob. 6MCQCh. 4.L1 - Which of the following is a primary bacterial cell...Ch. 4.L1 - Which of the following is present in both...Ch. 4.L1 - Metachromatic granules are concentrated ________...Ch. 4.L1 - Prob. 10MCQCh. 4.L1 - Prob. 11MCQCh. 4.L1 - Prob. 12MCQCh. 4.L1 - Prob. 13MCQCh. 4.L1 - Prob. 14MCQCh. 4.L1 - Prob. 15MCQCh. 4.L1 - To which taxonomic group do cyanobacteria belong?...Ch. 4.L1 - Prob. 17MCQCh. 4.L1 - The first living cells on earth would most likely...Ch. 4.L1 - Prob. 1CSRCh. 4.L1 - Prob. 2CSRCh. 4.L1 - What is a biofilm, and how did it form on the...Ch. 4.L1 - Label the parts on the bacterial cell featured...Ch. 4.L1 - Discuss the collection of properties that are used...Ch. 4.L1 - Describe the basic process of biofilm formation.Ch. 4.L1 - Prob. 4WCCh. 4.L1 - Prob. 5WCCh. 4.L2 - Using clay, demonstrate how cocci can divide in...Ch. 4.L2 - Prob. 2CTCh. 4.L2 - Prob. 3CTCh. 4.L2 - Prob. 4CTCh. 4.L2 - a. Name a bacterial group that uses chlorophyll to...Ch. 4.L2 - Propose a hypothesis to explain how bacteria and...Ch. 4.L2 - Prob. 7CTCh. 4.L2 - Prob. 8CTCh. 4.L2 - Describe the shapes and arrangements of bacteria...Ch. 4.L2 - Prob. 1VCCh. 4.L2 - What kinds of cells are shown here? Explain what...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
What is a Primary and Secondary Metabolite?; Author: Unicity International;https://www.youtube.com/watch?v=TRNUURm0agM;License: Standard Youtube License