To determine:
The period when primary oocytes and spermatocytes are produced and also the number of gametes that result from one diploid cell in females and males.
Introduction:
Gametogenesis is a process that involves the formation of gametes. This process occurs in male and female at different period. In males, formation of sperms occurs in seminiferous tubules of testes. In females, oogenesis, or formation of ova or eggs, occur in ovary.

Explanation of Solution
Pictorial representation:
Fig 1: The spermatogenesis in male and oogenesis in female.
The process of spermatogenesis occurs with start of puberty. At the time of puberty and during adulthood, differentiation of these cells led to the development of diploid primary spermatocytes. It further goes for first meiotic division that produces two spermatocytes that led to the development of four haploid spermatids. They are joined by cytoplasmic bridges and become haploid cells by separating from each other. These spermatids mature to form sperms or spermatozoa
The process of oogenesis occurs in females. During this process, differentiation of oogonia occurs into primary oocytes. Since it occurs before birth, a female is born with primary oocytes. Meiosis results in four cells. All the cells become sperms after meiosis in males while only one cell becomes ovum in females.
The process of meiosis results into four cells. In females, only one cell goes to form ovum while in males, all the four cells become sperms
Want to see more full solutions like this?
Chapter 40 Solutions
ACHIEVE FOR BIOLOGY:HOW LIFE WORKS-EBOOK
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





