Concept explainers
To explain:
“The difference in action between a hormone, a paracrine signal, a neurotransmitter and a pheromone”.
Introduction:
A neurotransmitter is a chemical released by the nerve cells in response to external stimuli. A hormone is a chemical substance which is secreted by the body cells. They are regulatory chemical substance that plays an important role in the growth and development of the body. There are three types of signals: endocrine signal, paracrine signal and autocrine signal. The pheromones are a chemical substance released by an organism in environment to transmit the signal to another organism. This pheromone affects the physiology and behaviour of other organisms.

Explanation of Solution
The difference between the action of a neurotransmitter, a hormone, a paracrine signal and a pheromone are described below:
Mode of action of neurotransmitter. | Mode of action of hormone. | Mode of action of paracrine. | Mode of action of pheromones. |
When there is a detection of external stimuli, the central nervous system sends signals to the nerve cells. This nerve impulse is then passed to the axon. The axons conduct the signal very quickly and release the neurotransmitter at the synapse. At the short distance of synapses, the neurotransmitters diffuse and pass the information to target organ. | A hormone is released by the organ system when it receives an internal stimulus. The released hormone then reaches the target site by travelling through the cardiovascular system. Then the target organ will respond to this signal. | Paracrine signalling is a form of signal through which two cells interact with each other. In paracrine signal, the hormone cannot enter into the bloodstream, rather its transmitted signal through receptor and influence the activity of nearby cells.
|
Pheromones are hormones secreted by organism into the environment. This hormone secreted by one organism that influence the behavioural and physiological activity of another organism which is present within the population. |
A neurotransmitter releases their signal to the axon of the same individual. | A hormone directly release into the bloodstream of an individual. | A paracrine send signals through the receptor to nearby cell of the same individual. | A pheromones are secreted to outside the body of an organism into the environment. |
The central nervous system sends impulses to axons to release the neurotransmitter and pass the information to target cells. A hormone pass information to target cells by travelling through the cardiovascular system. A paracrine signal influences the activity of nearby cells of the same individual. A pheromone signals influence the activity of other organisms that present within the populations and the endocrine hormone influence the activity of distant cells within the individual.
Want to see more full solutions like this?
Chapter 36 Solutions
ACHIEVE FOR BIOLOGY:HOW LIFE WORKS-EBOOK
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





