Concept explainers
Which of the following is not a defining characteristic of vertebrates?
- a. cranium
- b. hinged jaw
- c. vertebral column
- d. endoskeleton

Introduction: The vertebrates comprise of animals that have vertebral column in their body. The dorsal solid notochord changes into vertebral column where the vertebrae are the small bones connected together by the inter-vertebral disks. The vertebrae enable animals to travel large distances, and provides both strength and flexibility.
Answer to Problem 1TY
Correct answer: Hinged jaw is not a defining characteristic of the vertebrates. Hence, the correct answer is option b.
Explanation of Solution
Reason for correct answer:
The defining characteristic of any group should be present in most of the members of that group and the group can be identified on the basis of that character. The hinged jaw is the characteristic of coelacanths where hinged jaw helps to open their mouth wide open. This feature is not present in most of the vertebrates, hence it is not a defining characteristic of the vertebrates.
Option b is given as “hinged jaw”.
The presence of hinged jaw is not a defining characterstic of the vertebrates. Hence, the correct answer is option b.
Reasons for incorrect answer:
Option a. is given as, “cranium”.
The cranium is the cage like structure which enclose brain inside it. It is present in most of the vertebrate species, therefore cranium is also one of the defining characteristics of vertebrates. Hence, option a. is incorrect.
Option c. is given as, “vertebral column”.
The group has been named due to the presence of the vertebral column. It is also one of the basis of the classification in this group, therefore vertebral column is the one of the defining characteristic of vertebrates. Hence, option c. is incorrect.
Option d is given as, “endoskeleton”.
The endoskeleton is present in all the species of vertebrates and it is unique to vertebrate. It is a defining characteristic of vertebrates. Hence, option d. is incorrect.
Hence, the options a., c., and d are incorrect.
The defining characteristic of the vertebrates does not comprise of hinged jaws.
Want to see more full solutions like this?
Chapter 35 Solutions
Biology
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax



