
Concept explainers
To determine: Whether water will flow by osmosis from one plant cell with water potential of -1.5MPa to another plant cell with water potential of -1.8MPa.
Introduction: Water is the most crucial factor for a plant to perform its normal cellular functions. The water is absorbed by the roots. The movement of water from the roots to the leaves can be explained using cohesion tension theory of water transport. The water movement from the roots to the vascular tube (xylem) is facilitated by osmosis. Water potential plays an important role in understanding plant physiology because it helps to measure a cell’s ability to absorb water by osmosis.
To determine: The direction of water flow when a plant cell with a water potential water potential of -1.5MPa to another plant cell with water potential of -1.8MPa.
Introduction: Water is the most crucial factor for a plant to perform its normal cellular functions. The water is absorbed by the roots. The movement of water from the roots to the leaves can be explained using cohesion tension theory of water transport. The water movement from the roots to the vascular tube (xylem) is facilitated by osmosis. Water potential plays an important role in understanding plant physiology because it helps to measure a cell’s ability to absorb water by osmosis.

Want to see the full answer?
Check out a sample textbook solution
Chapter 35 Solutions
EBK BIOLOGY
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax




