The process of generating mature mRNA from the primary transcript is referred to as RNA processing. In eukaryotes, the process of transcription occurs in the nucleus and the process of translation occurs in the cytoplasm. In prokaryotes, the primary transcript will be immediately translated into protein. The primary transcript in eukaryotes should be modified to undergo the process of translation.

Question

Want to see more full solutions like this?

Answer 1

Question

Chapter 3.4, Problem 9SAQ

Summary Introduction

The process of generating mature mRNA from the primary transcript is referred to as RNA processing. In eukaryotes, the process of transcription occurs in the nucleus and the process of translation occurs in the cytoplasm. In prokaryotes, the primary transcript will be immediately translated into protein. The primary transcript in eukaryotes should be modified to undergo the process of translation.

Expert Solution & Answer

Explanation of Solution

The three mechanisms that are involved in the processing of RNA in eukaryotes are capping, polyadenylation, and splicing.

Capping:

In this mechanism, the 5’ end of the primary transcript is modified. This is carried out by the addition of a special nucleotide 7-methylguanosine to the 5’ end by the 5’-5’ triphosphate linkage. This addition is called 5’ cap is necessary for the translation process in eukaryotes. This is because the ribosome recognizes the mRNA only by its 5’ cap.

Polyadenylation:

To the 3’ end of the mRNA, a stretch of about 250 consecutive A-bearing adenylate nucleotide residues is added. The polyadenylation plays an important role in the exportation of mRNA into the cytoplasm. It also helps in stabilizing the RNA transcript.

Splicing:

The eukaryotic transcripts often contain both coding and noncoding sequences. The coding sequences are referred to as exons and the noncoding sequences are referred to as introns. The noncoding sequences are interspersed with the protein-coding sequences. For the translation of proteins, the noncoding introns should be removed from the transcript. The process of removal of introns is referred to as RNA splicing. This RNA splicing is catalyzed by the RNA-protein complex known as spliceosome. After the removal of introns, the exons are joined together.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

Answer 2

Question

Chapter 3.4, Problem 9SAQ

Summary Introduction

The process of generating mature mRNA from the primary transcript is referred to as RNA processing. In eukaryotes, the process of transcription occurs in the nucleus and the process of translation occurs in the cytoplasm. In prokaryotes, the primary transcript will be immediately translated into protein. The primary transcript in eukaryotes should be modified to undergo the process of translation.

Expert Solution & Answer

Explanation of Solution

The three mechanisms that are involved in the processing of RNA in eukaryotes are capping, polyadenylation, and splicing.

Capping:

In this mechanism, the 5’ end of the primary transcript is modified. This is carried out by the addition of a special nucleotide 7-methylguanosine to the 5’ end by the 5’-5’ triphosphate linkage. This addition is called 5’ cap is necessary for the translation process in eukaryotes. This is because the ribosome recognizes the mRNA only by its 5’ cap.

Polyadenylation:

To the 3’ end of the mRNA, a stretch of about 250 consecutive A-bearing adenylate nucleotide residues is added. The polyadenylation plays an important role in the exportation of mRNA into the cytoplasm. It also helps in stabilizing the RNA transcript.

Splicing:

The eukaryotic transcripts often contain both coding and noncoding sequences. The coding sequences are referred to as exons and the noncoding sequences are referred to as introns. The noncoding sequences are interspersed with the protein-coding sequences. For the translation of proteins, the noncoding introns should be removed from the transcript. The process of removal of introns is referred to as RNA splicing. This RNA splicing is catalyzed by the RNA-protein complex known as spliceosome. After the removal of introns, the exons are joined together.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Chapter 3.4, Problem 9SAQ

Summary Introduction

The process of generating mature mRNA from the primary transcript is referred to as RNA processing. In eukaryotes, the process of transcription occurs in the nucleus and the process of translation occurs in the cytoplasm. In prokaryotes, the primary transcript will be immediately translated into protein. The primary transcript in eukaryotes should be modified to undergo the process of translation.

Expert Solution & Answer

Explanation of Solution

The three mechanisms that are involved in the processing of RNA in eukaryotes are capping, polyadenylation, and splicing.

Capping:

In this mechanism, the 5’ end of the primary transcript is modified. This is carried out by the addition of a special nucleotide 7-methylguanosine to the 5’ end by the 5’-5’ triphosphate linkage. This addition is called 5’ cap is necessary for the translation process in eukaryotes. This is because the ribosome recognizes the mRNA only by its 5’ cap.

Polyadenylation:

To the 3’ end of the mRNA, a stretch of about 250 consecutive A-bearing adenylate nucleotide residues is added. The polyadenylation plays an important role in the exportation of mRNA into the cytoplasm. It also helps in stabilizing the RNA transcript.

Splicing:

The eukaryotic transcripts often contain both coding and noncoding sequences. The coding sequences are referred to as exons and the noncoding sequences are referred to as introns. The noncoding sequences are interspersed with the protein-coding sequences. For the translation of proteins, the noncoding introns should be removed from the transcript. The process of removal of introns is referred to as RNA splicing. This RNA splicing is catalyzed by the RNA-protein complex known as spliceosome. After the removal of introns, the exons are joined together.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Chapter 3.4, Problem 9SAQ

Summary Introduction

The process of generating mature mRNA from the primary transcript is referred to as RNA processing. In eukaryotes, the process of transcription occurs in the nucleus and the process of translation occurs in the cytoplasm. In prokaryotes, the primary transcript will be immediately translated into protein. The primary transcript in eukaryotes should be modified to undergo the process of translation.

Expert Solution & Answer

Explanation of Solution

The three mechanisms that are involved in the processing of RNA in eukaryotes are capping, polyadenylation, and splicing.

Capping:

In this mechanism, the 5’ end of the primary transcript is modified. This is carried out by the addition of a special nucleotide 7-methylguanosine to the 5’ end by the 5’-5’ triphosphate linkage. This addition is called 5’ cap is necessary for the translation process in eukaryotes. This is because the ribosome recognizes the mRNA only by its 5’ cap.

Polyadenylation:

To the 3’ end of the mRNA, a stretch of about 250 consecutive A-bearing adenylate nucleotide residues is added. The polyadenylation plays an important role in the exportation of mRNA into the cytoplasm. It also helps in stabilizing the RNA transcript.

Splicing:

The eukaryotic transcripts often contain both coding and noncoding sequences. The coding sequences are referred to as exons and the noncoding sequences are referred to as introns. The noncoding sequences are interspersed with the protein-coding sequences. For the translation of proteins, the noncoding introns should be removed from the transcript. The process of removal of introns is referred to as RNA splicing. This RNA splicing is catalyzed by the RNA-protein complex known as spliceosome. After the removal of introns, the exons are joined together.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 3.4, Problem 9SAQ

Summary Introduction

The process of generating mature mRNA from the primary transcript is referred to as RNA processing. In eukaryotes, the process of transcription occurs in the nucleus and the process of translation occurs in the cytoplasm. In prokaryotes, the primary transcript will be immediately translated into protein. The primary transcript in eukaryotes should be modified to undergo the process of translation.

Expert Solution & Answer

Explanation of Solution

The three mechanisms that are involved in the processing of RNA in eukaryotes are capping, polyadenylation, and splicing.

Capping:

In this mechanism, the 5’ end of the primary transcript is modified. This is carried out by the addition of a special nucleotide 7-methylguanosine to the 5’ end by the 5’-5’ triphosphate linkage. This addition is called 5’ cap is necessary for the translation process in eukaryotes. This is because the ribosome recognizes the mRNA only by its 5’ cap.

Polyadenylation:

To the 3’ end of the mRNA, a stretch of about 250 consecutive A-bearing adenylate nucleotide residues is added. The polyadenylation plays an important role in the exportation of mRNA into the cytoplasm. It also helps in stabilizing the RNA transcript.

Splicing:

The eukaryotic transcripts often contain both coding and noncoding sequences. The coding sequences are referred to as exons and the noncoding sequences are referred to as introns. The noncoding sequences are interspersed with the protein-coding sequences. For the translation of proteins, the noncoding introns should be removed from the transcript. The process of removal of introns is referred to as RNA splicing. This RNA splicing is catalyzed by the RNA-protein complex known as spliceosome. After the removal of introns, the exons are joined together.

Answer 6

Chapter 3.4, Problem 9SAQ

Summary Introduction

The process of generating mature mRNA from the primary transcript is referred to as RNA processing. In eukaryotes, the process of transcription occurs in the nucleus and the process of translation occurs in the cytoplasm. In prokaryotes, the primary transcript will be immediately translated into protein. The primary transcript in eukaryotes should be modified to undergo the process of translation.

Expert Solution & Answer

Explanation of Solution

The three mechanisms that are involved in the processing of RNA in eukaryotes are capping, polyadenylation, and splicing.

Capping:

In this mechanism, the 5’ end of the primary transcript is modified. This is carried out by the addition of a special nucleotide 7-methylguanosine to the 5’ end by the 5’-5’ triphosphate linkage. This addition is called 5’ cap is necessary for the translation process in eukaryotes. This is because the ribosome recognizes the mRNA only by its 5’ cap.

Polyadenylation:

To the 3’ end of the mRNA, a stretch of about 250 consecutive A-bearing adenylate nucleotide residues is added. The polyadenylation plays an important role in the exportation of mRNA into the cytoplasm. It also helps in stabilizing the RNA transcript.

Splicing:

The eukaryotic transcripts often contain both coding and noncoding sequences. The coding sequences are referred to as exons and the noncoding sequences are referred to as introns. The noncoding sequences are interspersed with the protein-coding sequences. For the translation of proteins, the noncoding introns should be removed from the transcript. The process of removal of introns is referred to as RNA splicing. This RNA splicing is catalyzed by the RNA-protein complex known as spliceosome. After the removal of introns, the exons are joined together.

Answer 7

Chapter 3.4, Problem 9SAQ

Summary Introduction

The process of generating mature mRNA from the primary transcript is referred to as RNA processing. In eukaryotes, the process of transcription occurs in the nucleus and the process of translation occurs in the cytoplasm. In prokaryotes, the primary transcript will be immediately translated into protein. The primary transcript in eukaryotes should be modified to undergo the process of translation.

Answer 8

Expert Solution & Answer

Explanation of Solution

The three mechanisms that are involved in the processing of RNA in eukaryotes are capping, polyadenylation, and splicing.

Capping:

In this mechanism, the 5’ end of the primary transcript is modified. This is carried out by the addition of a special nucleotide 7-methylguanosine to the 5’ end by the 5’-5’ triphosphate linkage. This addition is called 5’ cap is necessary for the translation process in eukaryotes. This is because the ribosome recognizes the mRNA only by its 5’ cap.

Polyadenylation:

To the 3’ end of the mRNA, a stretch of about 250 consecutive A-bearing adenylate nucleotide residues is added. The polyadenylation plays an important role in the exportation of mRNA into the cytoplasm. It also helps in stabilizing the RNA transcript.

Splicing:

The eukaryotic transcripts often contain both coding and noncoding sequences. The coding sequences are referred to as exons and the noncoding sequences are referred to as introns. The noncoding sequences are interspersed with the protein-coding sequences. For the translation of proteins, the noncoding introns should be removed from the transcript. The process of removal of introns is referred to as RNA splicing. This RNA splicing is catalyzed by the RNA-protein complex known as spliceosome. After the removal of introns, the exons are joined together.