The reason for the difference in the viability of the antibodies that are produces by one’s immune system and monoclonals that are delivered in passive immunization. Introduction: Monoclonal antibodies are produced artificially in the laboratories. A particular type of antigens is injected into the mice, and then its spleen is removed. The B cells are taken from the mice’s spleen and are fused with myeloma cancer cell line. The fusion results in the formation of hybridomas, which are used to produce monoclonal antibodies.

Question

Want to see the full answer?

Answer 1

Question

Chapter 34, Problem 4CT

Summary Introduction

To determine:

The reason for the difference in the viability of the antibodies that are produces by one’s immune system and monoclonals that are delivered in passive immunization.

Introduction:

Monoclonal antibodies are produced artificially in the laboratories. A particular type of antigens is injected into the mice, and then its spleen is removed. The B cells are taken from the mice’s spleen and are fused with myeloma cancer cell line. The fusion results in the formation of hybridomas, which are used to produce monoclonal antibodies.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?

Answer 2

Question

Chapter 34, Problem 4CT

Summary Introduction

To determine:

The reason for the difference in the viability of the antibodies that are produces by one’s immune system and monoclonals that are delivered in passive immunization.

Introduction:

Monoclonal antibodies are produced artificially in the laboratories. A particular type of antigens is injected into the mice, and then its spleen is removed. The B cells are taken from the mice’s spleen and are fused with myeloma cancer cell line. The fusion results in the formation of hybridomas, which are used to produce monoclonal antibodies.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 34, Problem 4CT

Summary Introduction

To determine:

The reason for the difference in the viability of the antibodies that are produces by one’s immune system and monoclonals that are delivered in passive immunization.

Introduction:

Monoclonal antibodies are produced artificially in the laboratories. A particular type of antigens is injected into the mice, and then its spleen is removed. The B cells are taken from the mice’s spleen and are fused with myeloma cancer cell line. The fusion results in the formation of hybridomas, which are used to produce monoclonal antibodies.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 34, Problem 4CT

Summary Introduction

To determine:

The reason for the difference in the viability of the antibodies that are produces by one’s immune system and monoclonals that are delivered in passive immunization.

Introduction:

Monoclonal antibodies are produced artificially in the laboratories. A particular type of antigens is injected into the mice, and then its spleen is removed. The B cells are taken from the mice’s spleen and are fused with myeloma cancer cell line. The fusion results in the formation of hybridomas, which are used to produce monoclonal antibodies.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 34, Problem 4CT

Summary Introduction

To determine:

The reason for the difference in the viability of the antibodies that are produces by one’s immune system and monoclonals that are delivered in passive immunization.

Introduction:

Monoclonal antibodies are produced artificially in the laboratories. A particular type of antigens is injected into the mice, and then its spleen is removed. The B cells are taken from the mice’s spleen and are fused with myeloma cancer cell line. The fusion results in the formation of hybridomas, which are used to produce monoclonal antibodies.

Answer 6

Chapter 34, Problem 4CT

Summary Introduction

To determine:

The reason for the difference in the viability of the antibodies that are produces by one’s immune system and monoclonals that are delivered in passive immunization.

Introduction:

Monoclonal antibodies are produced artificially in the laboratories. A particular type of antigens is injected into the mice, and then its spleen is removed. The B cells are taken from the mice’s spleen and are fused with myeloma cancer cell line. The fusion results in the formation of hybridomas, which are used to produce monoclonal antibodies.

Answer 7

Chapter 34, Problem 4CT

Summary Introduction

To determine:

The reason for the difference in the viability of the antibodies that are produces by one’s immune system and monoclonals that are delivered in passive immunization.

Introduction:

Monoclonal antibodies are produced artificially in the laboratories. A particular type of antigens is injected into the mice, and then its spleen is removed. The B cells are taken from the mice’s spleen and are fused with myeloma cancer cell line. The fusion results in the formation of hybridomas, which are used to produce monoclonal antibodies.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 34 - Prob. 1SQ Ch. 34 - Prob. 2SQ Ch. 34 - Which of the following is not considered to be...Ch. 34 - Prob. 4SQ Ch. 34 - Prob. 5SQ Ch. 34 - Name a defining characteristic of innate immunity.Ch. 34 - Prob. 7SQ Ch. 34 - Antibodies are ________. a. antigen receptors c....Ch. 34 - A dendritic cell engulfs a bacterium, then...Ch. 34 - Prob. 10SQ

Solution Summary: The author compares the viability of monoclonal antibodies produced by one's immune system and those delivered in passive immunization.

Videos

Want to see the full answer?

Chapter 34 Solutions