
Microbiology Fundamentals: A Clinical Approach - Standalone book
2nd Edition
ISBN: 9780078021046
Author: Marjorie Kelly Cowan Professor, Jennifer Bunn
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 3.3, Problem 8AYP
Summary Introduction
Todiscuss:
The reason why Gram-positive cell walls are stronger than Gram-negative cell walls.
Concept introduction:
A Danish physician Hans Christian Gram developed a technique of staining that determines two groups of bacteria that differ from each other. Gram-positive and Gram-negative bacteria differ due to the differences in the peptidoglycan layer of the cell envelope.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 3 Solutions
Microbiology Fundamentals: A Clinical Approach - Standalone book
Ch. 3.1 - List the structures all bacteria possess.Ch. 3.1 - Identify three structures some but not all...Ch. 3.1 - Describe three major shapes of bacteria.Ch. 3.1 - Provide at least four terms to describe bacterial...Ch. 3.2 - Prob. 5AYPCh. 3.2 - Prob. 6AYPCh. 3.3 - Prob. 1NPCh. 3.3 - Prob. 2NPCh. 3.3 - Differentiate between the two main types of...Ch. 3.3 - Prob. 8AYP
Ch. 3.3 - Prob. 9AYPCh. 3.4 - Prob. 10AYPCh. 3.4 - Prob. 11AYPCh. 3.4 - Prob. 3NPCh. 3.5 - Compare and contrast the major features of...Ch. 3.6 - Differentiate between Bergeys Manual of Systematic...Ch. 3.6 - Name four divisions ending in cutes and describe...Ch. 3.6 - Define a species in terms of bacteria.Ch. 3 - Prob. 1CTCh. 3 - Prob. 1MCQCh. 3 - From chapter 2, figure 2.18. Explain why some...Ch. 3 - Prob. 2CTCh. 3 - Prob. 2MCQCh. 3 - Prob. 3CTCh. 3 - Prob. 3MCQCh. 3 - Prob. 4CTCh. 3 - Prob. 4MCQCh. 3 - Prob. 5CTCh. 3 - Prob. 5MCQCh. 3 - Prob. 6MCQCh. 3 - Prob. 7MCQCh. 3 - Bacteria and archaea have a much greater diversity...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning