Videos
Test your knowledge of the five major classes of plant hormones (auxins, cytokinins, gibberellins, abscisic acid, ethylene) by matching one hormone to each lettered box. (Note that some hormones will match up to more than one box.)
To complete: The given map of the five major classes of plant hormones.
Concept introduction:
Plant hormones are chemical messengers that are produced in trace amounts, but profoundly affect the growth and development of a plant. These include auxins, cytokinins, gibberellins, abscisic acid and ethylene.
The plant hormones perform various functions such as promoting growth, breaking dormancy, mediating fruit ripening and providing tolerance to stress.
Explanation of Solution
Pictorial representation: Fig.1 shows the completed map representing the five major classes of plant hormones.
Fig.1: The five major classes of plant hormones.
(a)
Correct answer: Auxin.
Explanation: Auxins are a group of plant hormones that promotes cell elongation. They are produced by the apical meristems of shoot and root. They promote the growth of root and shoot of the plant. Hence the correct answer is auxin.
(b)
Correct answer: Gibberellins.
Explanation: The gibberellins are a group of plant hormones that stimulate the elongation of stem by promoting cell elongation. Hence the correct answer is gibberellins.
(c)
Correct answer: Auxin.
Explanation: Auxin is produced by the apical bud of the shoot and functions to inhibit the growth of axillary buds, a phenomenon called apical dominance. Hence, the correct answer is auxin.
(d)
Correct answer: cytokinin.
Explanation: The cytokinins are a group of plant hormones that stimulate rapid cell division in roots and shoots of the plant. It also promotes the growth of lateral buds, thereby nullifying the effects of auxin. Hence, the correct answer is cytokinin.
(e)
Correct answer: Auxin.
Explanation: In addition to cell elongation, the auxins also function to retard the abscission of leaves. It also plays a crucial role in nullifying the effects of ethylene. Hence, the correct answer is auxin.
(f)
Correct answer: Ethylene.
Explanation: Ethylene is a gaseous hormone that promotes ripening of fruit and abscission of leaves from trees. Hence, the correct answer is ethylene.
(g)
Correct answer: Gibberellin.
Explanation: The gibberellin is a plant hormone that promotes the germination of seed. It inhibits seed dormancy by nullifying the effects of abscisic acid. Hence the correct answer is gibberellin.
(h)
Correct answer: Abscisic acid.
Explanation: The abscisic acid is a plant hormone that is involved in the stress responses. It inhibits growth, promotes seed dormancy during winter or periods of drought. Hence, the correct answer is abscisic acid.
Want to see more full solutions like this?
Chapter 33 Solutions
CAMPBEL BIOLOGY:CONCEPTS & CONNECTIONS
- Don't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forwardBiology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forward
- Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forward
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning