PRIN.OF HUMAN ANATOMY (LL)
15th Edition
ISBN: 9781119662761
Author: Tortora
Publisher: WILEY
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 29, Problem 12CP
When does gastrulation occur?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 29 Solutions
PRIN.OF HUMAN ANATOMY (LL)
Ch. 29 - 1. What is pregnancy?
Ch. 29 - 2. What are the major events of each trimester?
Ch. 29 - Prob. 3CPCh. 29 - How is polyspermy prevented?Ch. 29 - Prob. 5CPCh. 29 - Describe the layers of a blastocyst and their...Ch. 29 - Prob. 7CPCh. 29 - 8. What are the functions of the trophoblast?
Ch. 29 - How is the bilaminar embryonic disc formed? ^Ch. 29 - Prob. 10CP
Ch. 29 - Prob. 11CPCh. 29 - When does gastrulation occur?Ch. 29 - Prob. 13CPCh. 29 - Prob. 14CPCh. 29 - Describe how neurulation occurs. Why is it...Ch. 29 - Prob. 16CPCh. 29 - Prob. 17CPCh. 29 - 18. How does the placenta form?
Ch. 29 - Prob. 19CPCh. 29 - Prob. 20CPCh. 29 - What is the origin of the structures of the head...Ch. 29 - Prob. 22CPCh. 29 - What changes occur in the limbs during the second...Ch. 29 - What are the general developmental trends during...Ch. 29 - Prob. 25CPCh. 29 - 26. What are some of the symptoms of fetal alcohol...Ch. 29 - How does cigarette smoking affect embryonic and...Ch. 29 - What conditions can be detected using fetal...Ch. 29 - List the hormones involved in pregnancy, and...Ch. 29 - 30. What structural and functional changes occur...Ch. 29 - 31. Which changes in pregnancy have an effect on...Ch. 29 - Prob. 32CPCh. 29 - Prob. 33CPCh. 29 - What happens during the stage of dilation, the...Ch. 29 - Why are respiratory and cardiovascular adjustments...Ch. 29 - Which hormones contribute to lactation? What is...Ch. 29 - Prob. 37CPCh. 29 - What do the terms genotype, phenotype, dominant,...Ch. 29 - What are genomic imprinting and nondisjunction?Ch. 29 - Give an example of incomplete dominance.Ch. 29 - 41. What is multiple-allele inheritance? Give an...Ch. 29 - Define complex inheritance and give an example.Ch. 29 - 43. Why does X-chromosome inactivation occur?
Ch. 29 - Kathy is breastfeeding her infant and is...Ch. 29 - 2. Jack has hemophilia, which is a sex-linked...Ch. 29 - Alisa has asked her obstetrician to save and...
Additional Science Textbook Solutions
Find more solutions based on key concepts
On what molecule does the anticodon appear? Explain the role of this molecule in protein synthesis.
Human Physiology: An Integrated Approach (8th Edition)
What process causes the Mediterranean intermediate Water MIW to become more dense than water in the adjacent At...
Applications and Investigations in Earth Science (9th Edition)
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (7th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY