
Biology: Life on Earth with Physiology (11th Edition)
11th Edition
ISBN: 9780133923001
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 28.3, Problem 2TC
Summary Introduction
To explain:
How might predators evolve to detect camouflaged prey.
Introduction:
“Camouflage” is an adaptation in which the insects resemble the color of the background environment and thus evade the attack of predators as they are not visible. Predators are larger organisms which eat the smaller organisms called as prey. Coevolution is the process of the simultaneous evolution of the new species of predator and prey due to the formation of new adaptive features.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 28 Solutions
Biology: Life on Earth with Physiology (11th Edition)
Ch. 28.1 - define a community and explain why community...Ch. 28.1 - Prob. 2CYLCh. 28.1 - Prob. 3CYLCh. 28.2 - Prob. 1CSCCh. 28.2 - Prob. 1CTCh. 28.2 - compare interspecific and intraspecific...Ch. 28.2 - explain how competitive exclusion leads to...Ch. 28.3 - define predator and parasite, and distinguish...Ch. 28.3 - Prob. 1HYEWCh. 28.3 - Prob. 1TC
Ch. 28.3 - provide examples of how predators and prey have...Ch. 28.3 - Prob. 2TCCh. 28.3 - Prob. 3CYLCh. 28.3 - Prob. 3TCCh. 28.3 - Prob. 4CYLCh. 28.3 - Prob. 4TCCh. 28.3 - Prob. 5CYLCh. 28.4 - Prob. 1CYLCh. 28.4 - Prob. 2CYLCh. 28.5 - Prob. 1CSCCh. 28.5 - Prob. 1CYLCh. 28.5 - Prob. 2CYLCh. 28.6 - explain the process of succession and its general...Ch. 28.6 - People have suppressed fires for decades. How...Ch. 28.6 - Prob. 2CYLCh. 28.6 - Prob. 2TCCh. 28 - Prob. 1ACCh. 28 - Prob. 1FIBCh. 28 - Prob. 1MCCh. 28 - Define an ecological community, and describe the...Ch. 28 - Prob. 2ACCh. 28 - Prob. 2FIBCh. 28 - Which of the following statements is not true of...Ch. 28 - Prob. 2RQCh. 28 - Prob. 3FIBCh. 28 - Prob. 3MCCh. 28 - Prob. 3RQCh. 28 - Prob. 4FIBCh. 28 - Prob. 4MCCh. 28 - Prob. 4RQCh. 28 - Prob. 5FIBCh. 28 - Prob. 5MCCh. 28 - Provide examples of two climax and two subclimax...Ch. 28 - Prob. 6FIBCh. 28 - Prob. 6RQCh. 28 - Prob. 7RQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
