Anatomy & Physiology: An Integrative Approach
2nd Edition
ISBN: 9780078024283
Author: Michael McKinley Dr., Valerie O'Loughlin, Theresa Bidle
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 28.3, Problem 14WDYL
Summary Introduction
To describe:
The specific effects of FSH (follicle stimulating hormone) and LH (luteinizing hormone).
Concept introduction:
The functioning of the female reproductive system is under the regulation of many hormones such as FSH (follicle stimulating hormone), LH (luteinizing hormone), estrogen and progesterone.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 28 Solutions
Anatomy & Physiology: An Integrative Approach
Ch. 28.1 - What general components make up the reproductive...Ch. 28.1 - What hormones begin to be secreted at puberty, and...Ch. 28.1 - What are the components of the urogenital...Ch. 28.2 - How do sex chromosomes differ from autosomes?Ch. 28.2 - Prob. 5WDYLCh. 28.2 - Prob. 6WDYLCh. 28.2 - Prob. 7WDYLCh. 28.2 - Prob. 8WDYLCh. 28.2 - Prob. 9WDYLCh. 28.2 - Prob. 10WDYL
Ch. 28.3 - What are the broad ligament, ovarian ligament, and...Ch. 28.3 - How are the primordial, primary, secondary, and...Ch. 28.3 - What follicles are present at birth? What...Ch. 28.3 - Prob. 14WDYLCh. 28.3 - What are the three phases of the ovarian cycle,...Ch. 28.3 - What are the four segments of the uterine tubes,...Ch. 28.3 - Prob. 17WDYLCh. 28.3 - Prob. 18WDYLCh. 28.3 - What are the three phases of the uterine cycle,...Ch. 28.3 - Compare and contrast the ovarian and uterine...Ch. 28.3 - What are the individual components of the female...Ch. 28.3 - Prob. 22WDYLCh. 28.3 - Prob. 23WDYLCh. 28.3 - Prob. 24WDYLCh. 28.4 - How does the scrotum help regulate the temperature...Ch. 28.4 - What are the major cell types in the seminiferous...Ch. 28.4 - What hormones are produced by the interstitial...Ch. 28.4 - How does a spermatogonium divide to produce...Ch. 28.4 - Prob. 29WDYLCh. 28.4 - Prob. 30WDYLCh. 28.4 - What are the specific functions of the accessory...Ch. 28.4 - How is seminal fluid different from semen?Ch. 28.4 - What are the similarities and differences between...Ch. 28.4 - Prob. 34WDYLCh. 28.4 - Prob. 35WDYLCh. 28.5 - Prob. 36WDYLCh. 28.5 - Prob. 37WDYLCh. 28.5 - Prob. 38WDYLCh. 28.5 - Prob. 39WDYLCh. 28.5 - Prob. 40WDYLCh. 28.5 - What factors affect the age that menarche first...Ch. 28.5 - Prob. 42WDYLCh. 28 - _____ 1. The female homologue to the glans of the...Ch. 28 - _____ 2. Ovulation occurs due to a dramatic peak...Ch. 28 - _____ 3. Which statement is accurate about the...Ch. 28 - _____ 4. Which structure contains a primary...Ch. 28 - _____ 5. In the male, what cells produce...Ch. 28 - Prob. 6DYKBCh. 28 - _____ 7. Spermatogonia divide by mitosis to form a...Ch. 28 - _____ 8. Sperm are stored in the _____, where they...Ch. 28 - _____ 9. Which statement is accurate about the...Ch. 28 - _____ 10. The paramesonephric ducts in the embryo...Ch. 28 - What are some anatomic similarities between the...Ch. 28 - What hormones are associated with the female...Ch. 28 - Prob. 13DYKBCh. 28 - List the uterine wall layers, and describe the...Ch. 28 - Compare and contrast the ovarian cycle phases and...Ch. 28 - Describe the relationship among the hypothalamus,...Ch. 28 - What is the function of sustentacular cells in the...Ch. 28 - Describe the process of spermatogenesis, including...Ch. 28 - How do erection and ejaculation occur in the male?Ch. 28 - What structures are formed from the...Ch. 28 - Prob. 1CALCh. 28 - Prob. 2CALCh. 28 - The physician reviews Luisas and Victors blood...Ch. 28 - Prob. 4CALCh. 28 - Prob. 5CALCh. 28 - Prob. 1CSLCh. 28 - Caitlyn had unprotected sex with her fianc...Ch. 28 - Prob. 3CSL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Reproduction: Crash Course Zoology #9; Author: CrashCourse;https://www.youtube.com/watch?v=poLyJDVjKlM;License: Standard youtube license