Lehninger Principles Of Biochemistry 7e & Study Guide And Solutions Manual For Lehninger Principles Of Biochemistry 7e
Lehninger Principles Of Biochemistry 7e & Study Guide And Solutions Manual For Lehninger Principles Of Biochemistry 7e
7th Edition
ISBN: 9781319125776
Author: David L. Nelson, Michael M. Cox
Publisher: W. H. Freeman
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 27, Problem 4P

(a)

Summary Introduction

To determine: The base sequence of mRNA that can be transcribed from the given strand (5)CTT AACACCCCTGACTTCGCGCCGTCG(3).

Introduction:

The double –stranded DNA is also known as duplex DNA. The template DNA obtained from the double stranded DNA act as the template for RNA. The non template strand is similar to the sequence of RNA.

(a)

Expert Solution
Check Mark

Explanation of Solution

The only change is that the DNA consists of thymine and RNA consists of uracil in place of thymine.

The mRNA strand that can be obtained from the transcription of template strand is given as,

(5)CTTAACACCCCTGACTTCGCGCCGTCG(3)Transcription(3)GAAUUGUGGGGACUGAAGCGCGGCAGC(5)

(b)

Summary Introduction

To determine: The amino acid sequence that could be coded by the mRNA in (a), starting from the 5 end.

Introduction:

The DNA is made up of two strands which inter wined with each other. Almost 300 different macromolecules incorporate to synthesize polypeptides. All the living organisms consist of similar type of genetic codes. The proteins are synthesized by the genetic codons.

(b)

Expert Solution
Check Mark

Explanation of Solution

The amino acids specify by mRNA sequences are as follow:

CGA-CGG-CGC-GAA-GUC-AGG-GGU-GUU-AAGArg-Arg-Arg-Glu-Val-Arg-Gly-Val-Lys

The 3 codons CGA specify the arginine amino acid, GAA specifies glutamine, GUC specifies valine, AGG specify amino acid arginine, 2 GGU codons specify glycine, GUU specifies valine and AAG specifies lysine. Thus, the amino acids which are specified by codons are leucine, alanine, valine and glutamine.

(c)

Summary Introduction

To determine: The resulting amino acid sequence is same or not, if the complementary (non template) strand of this DNA were transcribed and translated. Also explain the biological significance.

Introduction:

The proteins are synthesized by the genetic codons. Similar type of genetic codes is present in all the living organisms. These ribosomes link specific amino acids in a sequence which is specified by codons.

(c)

Expert Solution
Check Mark

Explanation of Solution

The complementary strand is antiparallel strand that does not have the same sequence in the opposite direction.

The amino acids which are encoded by the mRNA sequence obtained in (b) are:

(5)CTTAACACCCCTGACTTCGCGCCGTCG(3)(3)GAATTGTGGGGACTGAAGCGCGGCAGC(5)Transcription(5)CUUAACACCCCUGACUUCGCGCCGUCG(3)

This is the obtained sequence of mRNA that by non-template strand.

(5)CUU-AAC-ACC-CCU-GAC-UUC-GCG-CCG-UCG(3)Leu-Asn-ThrPro-Asp-Phe-Ala-Pro-Ser

The biological significance is that the RNA includes transcription from only one strand of duplex DNA which is specific. The RNA polymerase binds to the correct strand of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
Please draw out the molecular structures of each molecule and show how each enzyme + cofactor would affect the following molecule in the human metabolic pathway. (This is a metabolic map)
Please draw out the molecular structures of each molecule and show how an enzyme + cofactor would affect the following molecule in the human metabolic pathway to create energy.
Please draw out the molecular structures of each molecule and show how each enzyme + cofactor would affect the following molecule in the human metabolic pathway.
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Text book image
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Text book image
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Text book image
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY