The sequences of the mature RNA. Concept introduction: The sequence of the three mRNA nucleotides that codes for the amino acids during the translation process is called codon. Three nucleotides constitute a codon that codes for the single amino acid. The codon where the translation process initiates is the start codon, which is usually AUG that codes for methionine. The stop codon terminates the translation process. The stop codons are UAA, UGA, and UAG. Given: The sequence of the sense strand of a mammalian gene is as follows: TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.

Question

12. When glutamic acid is heated to 180°C., it loses a molecule of water to form a lactam. The bond that creates the lactam is an amide bond that forms between the amino nitrogen and the carbon of the side chain -COOH group. What is the most reasonable structure for this lactam? (NOTE: The structure of glutamic acid is shown in Question 1.) COOH COOH ا کچھ جو کچھ C D COOH B COOH E COOH

Answer 1

Question

Chapter 27, Problem 24CQ

Summary Introduction

To determine: The sequences of the mature RNA.

Concept introduction: The sequence of the three mRNA nucleotides that codes for the amino acids during the translation process is called codon. Three nucleotides constitute a codon that codes for the single amino acid. The codon where the translation process initiates is the start codon, which is usually AUG that codes for methionine. The stop codon terminates the translation process. The stop codons are UAA, UGA, and UAG.

Given: The sequence of the sense strand of a mammalian gene is as follows:

TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT

Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.

Summary Introduction

To determine: The sequences of encoded protein.

Concept introduction: The sequence of the three mRNA nucleotides that codes for the amino acids during the translation process is called codon. Three nucleotides constitute a codon that codes for the single amino acid. The codon where the translation process initiates is the start codon, which is usually AUG that codes for methionine. The stop codon terminates the translation process. The stop codons are UAA, UGA, and UAG.

Given: The sequence of the sense strand of a mammalian gene is as follows:

TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT

Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.

Expert Solution & Answer

Trending nowThis is a popular solution!

See solution

Check out sample textbook solution

Students have asked these similar questions

12. When glutamic acid is heated to 180°C., it loses a molecule of water to form a lactam. The bond that creates the lactam is an amide bond that forms between the amino nitrogen and the carbon of the side chain -COOH group. What is the most reasonable structure for this lactam? (NOTE: The structure of glutamic acid is shown in Question 1.) COOH COOH ا کچھ جو کچھ C D COOH B COOH E COOH

10. Which one of the following compounds is the major organic product of the series of reactions shown here? Ph A OH Ph B CO₂Et Br -H Ν ΚΑ CO₂Et 1. NaOEt 1. NaOH, H₂O 2. H3O+ 2. PhCH2CH2Br 3. heat NH2 Ph OH NH2 0 OH Ph OH NH2 Ph D NH2 E OH

1. What is the isoelectric point of glutamic acid? (Glutamic acid has pKa1 2.10, pKa2 4.07, pKaз 9.47) A) pH 2.1 D) pH 6.8 B) pH 3.1 C) pH 4.1 E) pH 9.5 HO NH2 Glutamic acid (shown without charges) OH