
Match each numbered item with the most closely related lettered item.
interstitial endocrine cells........

To review:
Match the term interstitial endocrine cells with the most closely related descriptions given below:
Link from scrotal chamber to peritoneal cavity
Stem cells that produce sperm
Compartment of the scrotum containing a testis
Site of lactation
Flagellum
Inner layer of the uterine wall
Enlarged portion of the uterine tube
Important estrogen hormone
Responsible for the production of androgens
Layer of smooth muscle deep to the dermis of the scrotum
Introduction:
Interstitial cells are also known as Leydig cells. These cells are found in the testicles in males lying close to the seminiferous tubules. These cells are polyhedral in shape with a large nucleus. The nucleus in these cells have three prominent nucleoli along with darkly stained peripheral heterochromatin. These cells have numerous lipid filled vesicles in it.
Explanation of Solution
These cells produce androgens in males, which is responsible for developing primary as well as the secondary male characteristics during puberty. Testosterone is the male hormone (androgen), which is produced in the males.
Androgens are often associated with male hormones, but they are also found in small quantities in the females. Androgens are responsible for the production of estrogens in females as well as in the males. The interstitial cells produce the testosterone only in the presence of luteinizing hormone (LH) in males.
Therefore, it can be concluded that the interstitial endocrine cells can be correctly matched with option (i) responsible for the production of androgens.
Want to see more full solutions like this?
Chapter 27 Solutions
Human Anatomy (8th Edition) - Standalone book
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning



