Connect With Learnsmart Labs Online Access For Prescott's Microbiology
11th Edition
ISBN: 9781260408997
Author: Joanne Willey
Publisher: Mcgraw-hill Higher Education (us)
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 26.3, Problem 1MI
Why is the ϕX174 genome considered plus stranded?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In a clinical context, a scientist is working with a viral DNA which is about 24000bps
long. There are two known variants of the virus that share almost the same DNA but
for a final fragment; with reference to Figure Q2b, the regions A and B are conserved
in both variants, while the region C differs and is either 320bps (variant 1) or 380bps
(variant 2). The scientist wants to set up a procedure to identify the variant they are
dealing with.
Viral dsDNA
(i)
(ii)
(iii)
Stable region (A)
Variable region (C)
Figure Q2b
Known sequence (B)
5-GACCTCAATGTCCAGCGGTACGCTCATAAA-3'
3'-CTGGAGTTACAGGTCGCCATGCGAGTATTT-5'
The scientists want to design a primer to amplify the variable region and to do
so, they sequence a small fragment (sequence B) the conserved region close
to the variable region C. Why is the scientist targeting a region outside of the
fragment of interest?
[3]
The sequence of the fragment B is reported in Figure Q2b. Suggest a primer
that can efficiently target this region and…
In the following gel showing stained bands of the Alu insertion sequence, what is the genotype
of individual 2?
941 bp
641 bp->>>
1 2 3 4 5 6
Homozygous for the 641 bp sequence that does not contain in the Alu insertion
Heterozygous, containing one 941 bp sequence and one 641 bp sequence
O Homozygous for the 941 bp sequence containing the Alu insertion
this is the worst figure i have ever seen. Evidently A and B are different but the same color? From what I understand A would be a sliding clamp, and B is Primase? Is F rna primer (I think personally) or representing the SSBP? this is the worst diagram ever.
the words that are for labeling are as follows: DNA polymerase III, sliding clamp, helicase, single-stranded binding protein (SSBPs), topoisomerase, RNA primer, newly synthesized DNA, primase, and DNA ligase.
Chapter 26 Solutions
Connect With Learnsmart Labs Online Access For Prescott's Microbiology
Ch. 26.1 - List some characteristics used in classifying...Ch. 26.1 - Prob. 2CCCh. 26.2 - Prob. 1MICh. 26.2 - Why do you think T4 evolved to initiate DNA...Ch. 26.2 - What function does HMC glycosylation serve?Ch. 26.2 - Explain why the T4 genome is circularly permuted.Ch. 26.2 - Prob. 1.2CCCh. 26.2 - How is a prophage induced to become active again?Ch. 26.2 - Describe the roles of cII, CIII, repressor (CI),...Ch. 26.2 - How do the temperate phages Mu and P1 differ from...
Ch. 26.2 - How is the envelope of this virus formed? How does...Ch. 26.2 - Why do cold sores recur throughout the lifetime of...Ch. 26.2 - In what part of the host cell does a herpesvirus...Ch. 26.2 - Many small DNA viruses rely on host enzymes for...Ch. 26.3 - Why is the X174 genome considered plus stranded?Ch. 26.3 - Why is it necessary for some ssDNA viruses to...Ch. 26.3 - Prob. 2CCCh. 26.3 - How do parvoviruses trick the host DNA polymerase...Ch. 26.4 - The rotavirus genome encodes 12 proteins. Suggest...Ch. 26.4 - Describe the life cycle of 6 phage. What makes...Ch. 26.4 - Prob. 3CCCh. 26.4 - In what ways are the life cycles of 6 and...Ch. 26.5 - Where in the host does the plus-strand RNA genome...Ch. 26.5 - How do some plus-strand viruses use polyproteins...Ch. 26.5 - What is an IRES? Why is it important?Ch. 26.5 - Prob. 3CCCh. 26.6 - How does that use of a segmented genome by...Ch. 26.6 - Prob. 2CCCh. 26.7 - Prob. 1MICh. 26.7 - Prob. 1CCCh. 26.7 - Prob. 2CCCh. 26.7 - Prob. 3CCCh. 26.8 - Prob. 1CCCh. 26.8 - Trace the HBV multiplication cycle, paying...Ch. 26 - Prob. 1RCCh. 26 - Prob. 2RCCh. 26 - Prob. 3RCCh. 26 - Prob. 4RCCh. 26 - No temperate RNA phages have yet been discovered....Ch. 26 - The choice between lysogeny and lysis is...Ch. 26 - Prob. 3ALCh. 26 - You are studying RNA viruses and have discovered a...Ch. 26 - Prob. 5ALCh. 26 - Prob. 6AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’arrow_forwardDoes Z-DNA have major and minor grooves? Explain.arrow_forwardBelow is a portion of an exon from a gene that encodes protein Y in the genome of the plant Brassica. Wildtype DNA3’ CTT AAT GCT CCG AAT CCA 5’ template strand5’ GAA TTA CGA GGC TTA GGT 3’ non-template strand A new strain (Strain X) of Brassica is identified with the same region of the gene coding for protein Y:3’ CTT AAT GCT GCG AAT CCA 5’ template strand5’ GAA TTA CGA CGC TTA GGT 3’ non-template strand Compare the sequence of Wildtype with Strain X DNA, and note the following: Whether there is a mutation. If there is a mutation, what is the type of mutation (be as specific as possible) and explain the rationale for your decision. Assuming this is the only difference between the Wildtype and Strain X, describe the potential impact of the mutation on the structure and function of the protein.arrow_forward
- Primer1: seq1 atatatatccccccatcactgggggg Primer 2: seq2 tatatactagggtacgtatgccccccarrow_forwardGiven the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'arrow_forwardWhat is the conformation of the glycosidic bond (i.e. orientation of the nucleobase relative to the the sugar) in the B-form of DNA? syn anti alpha heteroarrow_forward
- The DNA of a deletion of alpha bacteriophage has a length of 15 micrometers instead of 17 micrometers? How many base pairs are missing from this mutant?arrow_forwardBelow is a portion of an exon from a gene that encodes protein X in the genome of the plant Arabidopsis. Wildtype DNA3’ TTC AAT GCT CCG AAT ACC 5’ template strand5’ AAG TTA CGA GGC TTA TGG 3’ non-template strand A new strain (Strain B) of Arabidopsis is identified with the same region of the gene coding for protein X: 3’ TTC AAT GCT CCC AAT ACC 5’ template strand5’ AAG TTA CGA GGG TTA TGG 3’ non-template strand Compare the two DNA sequences and look for any differences. Based on what you find a. There is no mutation in Strain B compared to Strain A. b. After the point of the mutation, all the amino acids encoded by the Strain B template will be different than the Strain A protein X. c. Protein X made from the Strain B template will be much shorter than protein X made from the Strain A template d. Protein X from Strain B will have one amino acid difference that would not affect protein function. e. There is a mutation but there will not be any difference in the…arrow_forwardWhat is a recombination unit in the context of the present analysis? How does it differ from the map units used in eukaryote genetics?arrow_forward
- For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'arrow_forwardWhy is it preferable for the delta G of the hairpin loop to be more positive in Primer desgin?arrow_forwardFor the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
genetic recombination strategies of bacteria CONJUGATION, TRANSDUCTION AND TRANSFORMATION; Author: Scientist Cindy;https://www.youtube.com/watch?v=_Va8FZJEl9A;License: Standard youtube license