Biology
Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 26.3, Problem 1CS

Core Skill: Modeling The goal of this modeling challenge is to revise the model shown in Figure 26.22 to account for recent data indicating that some modern Africans have a small amount of Neanderthal DNA.

Modeling Challenge: As discussed in this section, between 1% and 4% of the DNA of modern humans of European descent is derived from that of Neanderthals. Though most modern humans of African descent do not carry Neanderthal DNA, recent evidence has shown that some of them carry a very small amount. Assuming that the presence of this Neanderthal DNA is not due to recent interbreeding between modern humans of European and African descent, revise the model shown in Figure 26.22 to account for the observation.

Chapter 26.3, Problem 1CS, Core Skill: Modeling The goal of this modeling challenge is to revise the model shown in Figure

Figure 26.22 A simplified model for the origin and spread of Homo sapiens throughout the world. This map, based on differences of mtDNA throughout current members of the world’s population, suggests Homo sapiens originated in East Africa. About 100,000 years ago, the species spread into the Middle East and from there to Europe, Asia, Australia, and the Americas.

Blurred answer
Students have asked these similar questions
Using the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and species of the following DNA sequence: TATGCCCTGGTTATCTTCGAGATGGTCCACCTGAAGGAGCTGGGGCTTTATAACCTCATG Gene: Insulin Receptor (INSR), Species: Mus Musculus Gene: Insulin Receptor (INS), Species: Homo Sapiens Gene: Epidermal Growth Factor Receptor (EGFR), Species: Homo Sapiens Gene: Epidermal Growth Factor Receptor (EGFR), Species: Mus Musculus
DNA Profiling
Do not use chatgpt.
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Phylogenetic Mysteries: Crash Course Zoology #12; Author: CrashCourse;https://www.youtube.com/watch?v=cVaw7nF72Aw;License: Standard youtube license