The evidence for the hypothesis that life originated on earth by the creation and polymerization of small organic molecules by natural process. Introduction: The organic molecules are structural part of amino acids, proteins, carbohydrates and other nutrients which are taken daily by living organisms in the form of diet. Carbon, nitrogen, oxygen, hydrogen are some of the essential organic molecules.

Question

Want to see more full solutions like this?

Answer 1

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 2.6, Problem 14SAQ

Summary Introduction

To determine:

The evidence for the hypothesis that life originated on earth by the creation and polymerization of small organic molecules by natural process.

Introduction:

The organic molecules are structural part of amino acids, proteins, carbohydrates and other nutrients which are taken daily by living organisms in the form of diet. Carbon, nitrogen, oxygen, hydrogen are some of the essential organic molecules.

Expert Solution & Answer

Explanation of Solution

The DNA and RNA are the vital parts of living organisms. The nucleotides form the major structure of DNA and are made-up of group forming organic molecules. This is the reason why organic molecules are involved in the origin of life. In previous times, the proteins were found in the human body, but no one knew the evolutionary history of proteins. An evolutionary hypothesis suggested that in early life t-RNA (transfer ribonucleic acid) like molecules might have served different functions. The proposal suggested that RNA were the early precursors of ribosomes, which also facilitated the replication of other RNAs.

The researchers hypothesized that t-RNA bound to amino acids may act as simple catalysts which facilitates more accuracy in RNA synthesis. After some time, amino acids were brought close in building up of RNA molecules that might have polymerized and form the polypeptide chains. The formation of polypeptides is favored by natural selection, and it enhanced the replication of RNA molecules that brought proteins into the chemistry of life.

Conclusion

The polymerization of organic molecules forms polymers and proteins that make the essential part of human life.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

Answer 2

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 2.6, Problem 14SAQ

Summary Introduction

To determine:

The evidence for the hypothesis that life originated on earth by the creation and polymerization of small organic molecules by natural process.

Introduction:

The organic molecules are structural part of amino acids, proteins, carbohydrates and other nutrients which are taken daily by living organisms in the form of diet. Carbon, nitrogen, oxygen, hydrogen are some of the essential organic molecules.

Expert Solution & Answer

Explanation of Solution

The DNA and RNA are the vital parts of living organisms. The nucleotides form the major structure of DNA and are made-up of group forming organic molecules. This is the reason why organic molecules are involved in the origin of life. In previous times, the proteins were found in the human body, but no one knew the evolutionary history of proteins. An evolutionary hypothesis suggested that in early life t-RNA (transfer ribonucleic acid) like molecules might have served different functions. The proposal suggested that RNA were the early precursors of ribosomes, which also facilitated the replication of other RNAs.

The researchers hypothesized that t-RNA bound to amino acids may act as simple catalysts which facilitates more accuracy in RNA synthesis. After some time, amino acids were brought close in building up of RNA molecules that might have polymerized and form the polypeptide chains. The formation of polypeptides is favored by natural selection, and it enhanced the replication of RNA molecules that brought proteins into the chemistry of life.

Conclusion

The polymerization of organic molecules forms polymers and proteins that make the essential part of human life.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 2.6, Problem 14SAQ

Summary Introduction

To determine:

The evidence for the hypothesis that life originated on earth by the creation and polymerization of small organic molecules by natural process.

Introduction:

The organic molecules are structural part of amino acids, proteins, carbohydrates and other nutrients which are taken daily by living organisms in the form of diet. Carbon, nitrogen, oxygen, hydrogen are some of the essential organic molecules.

Expert Solution & Answer

Explanation of Solution

The DNA and RNA are the vital parts of living organisms. The nucleotides form the major structure of DNA and are made-up of group forming organic molecules. This is the reason why organic molecules are involved in the origin of life. In previous times, the proteins were found in the human body, but no one knew the evolutionary history of proteins. An evolutionary hypothesis suggested that in early life t-RNA (transfer ribonucleic acid) like molecules might have served different functions. The proposal suggested that RNA were the early precursors of ribosomes, which also facilitated the replication of other RNAs.

The researchers hypothesized that t-RNA bound to amino acids may act as simple catalysts which facilitates more accuracy in RNA synthesis. After some time, amino acids were brought close in building up of RNA molecules that might have polymerized and form the polypeptide chains. The formation of polypeptides is favored by natural selection, and it enhanced the replication of RNA molecules that brought proteins into the chemistry of life.

Conclusion

The polymerization of organic molecules forms polymers and proteins that make the essential part of human life.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 2.6, Problem 14SAQ

Summary Introduction

To determine:

The evidence for the hypothesis that life originated on earth by the creation and polymerization of small organic molecules by natural process.

Introduction:

The organic molecules are structural part of amino acids, proteins, carbohydrates and other nutrients which are taken daily by living organisms in the form of diet. Carbon, nitrogen, oxygen, hydrogen are some of the essential organic molecules.

Expert Solution & Answer

Explanation of Solution

The DNA and RNA are the vital parts of living organisms. The nucleotides form the major structure of DNA and are made-up of group forming organic molecules. This is the reason why organic molecules are involved in the origin of life. In previous times, the proteins were found in the human body, but no one knew the evolutionary history of proteins. An evolutionary hypothesis suggested that in early life t-RNA (transfer ribonucleic acid) like molecules might have served different functions. The proposal suggested that RNA were the early precursors of ribosomes, which also facilitated the replication of other RNAs.

The researchers hypothesized that t-RNA bound to amino acids may act as simple catalysts which facilitates more accuracy in RNA synthesis. After some time, amino acids were brought close in building up of RNA molecules that might have polymerized and form the polypeptide chains. The formation of polypeptides is favored by natural selection, and it enhanced the replication of RNA molecules that brought proteins into the chemistry of life.

Conclusion

The polymerization of organic molecules forms polymers and proteins that make the essential part of human life.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 2.6, Problem 14SAQ

Summary Introduction

To determine:

The evidence for the hypothesis that life originated on earth by the creation and polymerization of small organic molecules by natural process.

Introduction:

The organic molecules are structural part of amino acids, proteins, carbohydrates and other nutrients which are taken daily by living organisms in the form of diet. Carbon, nitrogen, oxygen, hydrogen are some of the essential organic molecules.

Expert Solution & Answer

Explanation of Solution

The DNA and RNA are the vital parts of living organisms. The nucleotides form the major structure of DNA and are made-up of group forming organic molecules. This is the reason why organic molecules are involved in the origin of life. In previous times, the proteins were found in the human body, but no one knew the evolutionary history of proteins. An evolutionary hypothesis suggested that in early life t-RNA (transfer ribonucleic acid) like molecules might have served different functions. The proposal suggested that RNA were the early precursors of ribosomes, which also facilitated the replication of other RNAs.

The researchers hypothesized that t-RNA bound to amino acids may act as simple catalysts which facilitates more accuracy in RNA synthesis. After some time, amino acids were brought close in building up of RNA molecules that might have polymerized and form the polypeptide chains. The formation of polypeptides is favored by natural selection, and it enhanced the replication of RNA molecules that brought proteins into the chemistry of life.

Conclusion

The polymerization of organic molecules forms polymers and proteins that make the essential part of human life.

Answer 6

Chapter 2.6, Problem 14SAQ

Summary Introduction

To determine:

The evidence for the hypothesis that life originated on earth by the creation and polymerization of small organic molecules by natural process.

Introduction:

The organic molecules are structural part of amino acids, proteins, carbohydrates and other nutrients which are taken daily by living organisms in the form of diet. Carbon, nitrogen, oxygen, hydrogen are some of the essential organic molecules.

Expert Solution & Answer

Explanation of Solution

The DNA and RNA are the vital parts of living organisms. The nucleotides form the major structure of DNA and are made-up of group forming organic molecules. This is the reason why organic molecules are involved in the origin of life. In previous times, the proteins were found in the human body, but no one knew the evolutionary history of proteins. An evolutionary hypothesis suggested that in early life t-RNA (transfer ribonucleic acid) like molecules might have served different functions. The proposal suggested that RNA were the early precursors of ribosomes, which also facilitated the replication of other RNAs.

The researchers hypothesized that t-RNA bound to amino acids may act as simple catalysts which facilitates more accuracy in RNA synthesis. After some time, amino acids were brought close in building up of RNA molecules that might have polymerized and form the polypeptide chains. The formation of polypeptides is favored by natural selection, and it enhanced the replication of RNA molecules that brought proteins into the chemistry of life.

Conclusion

The polymerization of organic molecules forms polymers and proteins that make the essential part of human life.

Answer 7

Chapter 2.6, Problem 14SAQ

Summary Introduction

To determine:

The evidence for the hypothesis that life originated on earth by the creation and polymerization of small organic molecules by natural process.

Introduction:

The organic molecules are structural part of amino acids, proteins, carbohydrates and other nutrients which are taken daily by living organisms in the form of diet. Carbon, nitrogen, oxygen, hydrogen are some of the essential organic molecules.

Answer 8

Expert Solution & Answer

Explanation of Solution

The DNA and RNA are the vital parts of living organisms. The nucleotides form the major structure of DNA and are made-up of group forming organic molecules. This is the reason why organic molecules are involved in the origin of life. In previous times, the proteins were found in the human body, but no one knew the evolutionary history of proteins. An evolutionary hypothesis suggested that in early life t-RNA (transfer ribonucleic acid) like molecules might have served different functions. The proposal suggested that RNA were the early precursors of ribosomes, which also facilitated the replication of other RNAs.

The researchers hypothesized that t-RNA bound to amino acids may act as simple catalysts which facilitates more accuracy in RNA synthesis. After some time, amino acids were brought close in building up of RNA molecules that might have polymerized and form the polypeptide chains. The formation of polypeptides is favored by natural selection, and it enhanced the replication of RNA molecules that brought proteins into the chemistry of life.