Lehninger Principles of Biochemistry
Lehninger Principles of Biochemistry
7th Edition
ISBN: 9781464126116
Author: David L. Nelson, Michael M. Cox
Publisher: W. H. Freeman
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 26, Problem 14DAP

(a)

Summary Introduction

To explain: The process by which the result given in question is consistent with posttranscriptional modification of the AMPA receptor mRNA .

Introduction:

The molecular method through which the cells make discrete changes to specific nucleotide sequences within an RNA molecule is known as RNA editing. RNA editing refers to the editing events that are the insertion, deletion, and base substitution of nucleotides within the edited RNA molecule.

(a)

Expert Solution
Check Mark

Explanation of Solution

The complementary cDNA is formed from the mRNA by the process known as reverse transcription of DNA. Here, in this the mRNA sequence of AMPA receptor is CGG. This is the reason that genomic DNA has the CAG sequences. CAG sequences are found commonly in the primary transcript. The CAG is then modified to form CGG.

(b)

Summary Introduction

To explain: The reason for the different products that are formed from the edited and unedited mRNAs.

Introduction:

RNA editing means that editing events means insertion, deletion, and base substitution of nucleotides within the edited RNA molecule. Post transcriptional regulation stands for the regulation of gene expression at. It is the process in which primary transcript of RNA is converted into a mature RNA.

(b)

Expert Solution
Check Mark

Explanation of Solution

The unedited mRNA sequence remains same that of DNA just thymine is replaced by uracil.

The unedited mRNA has the sequences (site of editing is indicated by A).

5-GUCUCUGGUUUUCCUUGGGUGCCUUUAUGCAGCAAGGAUGCGAUAUUUCGCCAAG-3

The annealing of primer 1 is shown as follows:

GUCUCUGGUUUUCCUUGGGUGCCUUUAUGCAGCAAGGAUGCGAUAUUUCGCCAAG||||||||||||||||||||||||CGTTCGTACGCTATAAAGCGGTTC

The cDNA is formed from right to left and is as follows:

GUCUCUGGUUUUCCUUGGGUGCCUUUAUGCAGCAAGGAUGCGAUAUUUCGCCAAG CAGAGACCAAAA GGAACCCACGGAAA TACG   TCGTTCCTACGC  TATAAAGCGGTTC

The resulted cDNA is as follows:

3-CAGAGACCAAAAGGAACCCACGGAAATACGTCGTTCCTACGCTATAAAGCGGTTC-5

The annealing of primer 2 is shown as follows:

CAGAGACCAAAACCTTGGGTGCCTTTA|||||||||||||||GGAACCCACGGAAATACGTCGTTCCTACGCTATAAAGCGGTTC

The nucleotides are added to 3 end of the primer by DNA polymerase. The complementary nucleotides are added when moving from left to right. The 3-OH is not present in A of ddATP, the chain elongation does not takes place. The new formed DNA is marked and is as follows:

CAGAGACCAAAACCTTGGGTGCCTTTAT_G_C_A_|||||||||||||||||||GGAACCCACGGAAATACGTTCGTTCCTACGCTATAAAGCGGTTC

The nineteen nucleotides are formed for unedited transcript. The A is replaced by G and in the cDNA, this correlates to C.

CAGAGACCAAAACCTTGGGTGCCTTTA|||||||||||||||GGAACCCACGGAAATACGCCGTTCCTACGCTATAAAGCGGTTC

The edited bases are elongated by DNA polymerase and will terminate at consecutive T in cDNA. The newly formed DNA is marked and is as follows:

CAGAGACCAAAACCTTGGGTGCCTTTA|||||||||||||||GGAACCCACGGAAATT_G_C_G_G_C_A_|||||||ACGCCGTTCCTACGCTATAAAGCGGTTC

The DNA polymerase is elongated and the edited base stops at the next thymine residue and gives the product of 22 nucleotides.

(c)

Summary Introduction

To determine: The key weakness in the argument that the editing machinery consists of protein.

Introduction:

RNA editing means that editing events means insertion, deletion, and base substitution of nucleotides within the edited RNA molecule. Post transcriptional regulation stands for the regulation of gene expression at. It is the process in which primary transcript of RNA is converted into a mature RNA.

(c)

Expert Solution
Check Mark

Explanation of Solution

To disrupt the protein function proteases and heat treatment methods are used, this will inhibit the editing event. Nucleases will act only on nucleic acid, nut do not affect the protein.

This clash revels that the disrupting treatment of protein will not halt the process of editing. In the absence of enzyme, the process of editing and degradation of mRNA will not get disturbed.

(d)

Summary Introduction

To determine: The importance of using [α-32P] ATP rather than [β-32P] ATP or [γ-32P] ATP in the experiment.

Introduction:

RNA editing means that editing events means insertion, deletion, and base substitution of nucleotides within the edited RNA molecule. Post transcriptional regulation stands for the regulation of gene expression at. It is the process in which primary transcript of RNA is converted into a mature RNA.

(d)

Expert Solution
Check Mark

Explanation of Solution

The alpha-phosphate of the nucleoside triphosphate is inserted into the polynucleotide. In this researchers have labeled added phosphates, then none product will have the radio labeled phosphate.

(e)

Summary Introduction

To determine: The importance of using [α-32P] ATP rather than [β-32P] GTP or [γ-32P] UTP in the experiment.

Introduction:

RNA editing means that editing events means insertion, deletion, and base substitution of nucleotides within the edited RNA molecule. Post transcriptional regulation stands for the regulation of gene expression at. It is the process in which primary transcript of RNA is converted into a mature RNA.

(e)

Expert Solution
Check Mark

Explanation of Solution

In the given reaction it is clear that only one adenine residue is edited, so the fate of other adenine residues in the sequence will change and this will change the sequence of the whole strand. So, the adenine residue in sequence becomes important for further studies. These changes will help in understanding the importance of using [α-32P] ATP than [β-32P] GTP or [γ-32P].

(f)

Summary Introduction

To determine: The process by which the entire A nucleotide was removed and replaced by I nucleotide.

Introduction:

RNA editing means that editing events means insertion, deletion, and base substitution of nucleotides within the edited RNA molecule. Post transcriptional regulation stands for the regulation of gene expression at. It is the process in which primary transcript of RNA is converted into a mature RNA.

(f)

Expert Solution
Check Mark

Explanation of Solution

The ATP is only labeled, if the whole nucleotide were removed all type of radioactivity have been detached from the mRNA. Since, the unmodified AMP containing P32 is present in the chromatographic plate.

(g1)

Summary Introduction

To determine: The effect of result that exclude removal of the A base followed by replacement with I base as a mechanism of editing.

Introduction:

RNA editing means that editing events means insertion, deletion, and base substitution of nucleotides within the edited RNA molecule. Post transcriptional regulation stands for the regulation of gene expression at. It is the process in which primary transcript of RNA is converted into a mature RNA.

(g1)

Expert Solution
Check Mark

Explanation of Solution

In the presence of AMP, if any base is replaced. This indicates that A has changed to I. This alteration occurs without the removal of H at the position of 2 and 8. Hydrolytic mechanism is the process due to which, these chemical changes occur.

If the bases were removed or replaced then only AMP will appear but the presence of IMP indicates that base A is replaced with I base. This replacement takes place without the removal of hydrogen. So if A is not replaced by I then editing will not occur and AMP will not change in IMP.

(g2)

Summary Introduction

To determine: The mechanism behind the editing process in the replacement of A base to I base

Introduction:

RNA editing means that editing events means insertion, deletion, and base substitution of nucleotides within the edited RNA molecule. Post transcriptional regulation stands for the regulation of gene expression at. It is the process in which primary transcript of RNA is converted into a mature RNA.

(g2)

Expert Solution
Check Mark

Explanation of Solution

In the presence of AMP, if any base is replaced. This indicates that A has changed to I. This alteration occurs without the removal of H at the position of 2 and 8. Hydrolytic mechanism is the process due to which, these chemical changes occur.

(h)

Summary Introduction

To determine: The change that occur in Gln to Arg in the protein sequences in the two forms of AMPA receptor.

Introduction:

RNA editing means that editing events means insertion, deletion, and base substitution of nucleotides within the edited RNA molecule. Post transcriptional regulation stands for the regulation of gene expression at. It is the process in which primary transcript of RNA is converted into a mature RNA.

(h)

Expert Solution
Check Mark

Explanation of Solution

The codon that will change under this process is CAG. This CAG will convert into CIG. This codon is known as CGG.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
Please draw out the following metabolic pathways: (Metabolic Map) Mitochondrion: TCA Cycle & GNG, Electron Transport, ATP Synthase, Lipolysis, Shuttle Systems Cytoplasm: Glycolysis & GNG, PPP (Pentose Phosphate Pathway), Glycogen, Lipogenesis,  Transporters and Amino Acids Control: Cori/ Glc-Ala cycles, Insulin/Glucagon Reg, Local/Long Distance Regulation, Pools Used Correctly
Please help provide me an insight of what to draw for the following metabolic pathways: (Metabolic Map) Mitochondrion: TCA Cycle & GNG, Electron Transport, ATP Synthase, Lipolysis, Shuttle Systems Cytoplasm: Glycolysis & GNG, PPP (Pentose Phosphate Pathway), Glycogen, Lipogenesis,  Transporters and Amino Acids Control: Cori/ Glc-Ala cycles, Insulin/Glucagon Reg, Local/Long Distance Regulation, Pools Used Correctly
write ionization equilibrium
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Text book image
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Text book image
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Text book image
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY