Inquiry into Life
16th Edition
ISBN: 9781260482638
Author: Mader, Sylvia
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 25.1, Problem 1QTC
Based on Chargaff’s rules, if a segment of DNA is composed of 20% adenine (A) bases, what is the percentage of guanine (G)?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Based on Chargaff’s rules, if a segment of DNA is composed of 20% adenine (A) bases, what is the percentage of guanine (G)?
A circular, double-stranded DNA contains 2100 base pairs. The
solution conditions are such that DNA has 10.5 bp/turn.
(a) What is Lo for this DNA?
(b) The DNA is found to have 12 left-handed superhelical turns.
What is the superhelix density o?
Assume that the molar percentage of thymine in a double stranded DNA is 20. What are the percentages of the four bases (G, C, T, A)?
b. The base content of a sample of DNA is as follows: A=31% G=31% T=19% C=19%. What conclusion can be drawn from this information?
Chapter 25 Solutions
Inquiry into Life
Ch. 25.1 - Summarize the experiment that enabled scientist to...Ch. 25.1 - Prob. 2LOCh. 25.1 - Based on Chargaff’s rules, if a segment of DNA is...Ch. 25.1 - Watson and Crick’s discovery of DNA is clearly one...Ch. 25.1 - Prob. 3QTCCh. 25.1 - Summarize the significance off the Griffith and...Ch. 25.1 - Prob. 2CYPCh. 25.1 - Prob. 3CYPCh. 25.2 - Prob. 1LOCh. 25.2 - Prob. 2LO
Ch. 25.2 - Explain why DNA replication is said to be...Ch. 25.2 - Prob. 2CYPCh. 25.3 - Describe the role of RNA molecules in gene...Ch. 25.3 - Prob. 2LOCh. 25.3 - Prob. 3LOCh. 25.3 - Prob. 4LOCh. 25.3 - Prob. 1CYPCh. 25.3 - Describe the movement of information from the...Ch. 25.3 - Discuss why the genetic code is said to be...Ch. 25.4 - Prob. 1LOCh. 25.4 - Prob. 2LOCh. 25.4 - Prob. 3LOCh. 25.4 - Prob. 1CYPCh. 25.4 - Prob. 2CYPCh. 25.4 - Prob. 3CYPCh. 25.5 - Summarize the causes of gene mutations.Ch. 25.5 - Prob. 2LOCh. 25.5 - Prob. 3LOCh. 25.5 - Prob. 1QTCCh. 25.5 - Prob. 2QTCCh. 25.5 - Prob. 1CYPCh. 25.5 - Prob. 2CYPCh. 25.5 - Prob. 3CYPCh. 25.5 - Which of these cancer preventive measures are you...Ch. 25.5 - Why do you think tobacco use increase the risk of...Ch. 25.5 - Why does the use of tanning beds also increase the...Ch. 25 - Prob. S2.8BYBCh. 25 - Section 2.8 How does the structure of DNA differ...Ch. 25 - Prob. S23.1BYBCh. 25 - Prob. 1ACh. 25 - Prob. 2ACh. 25 - Prob. 3ACh. 25 - Prob. 4ACh. 25 - Prob. 5ACh. 25 - Prob. 6ACh. 25 - Prob. 7ACh. 25 - Prob. 8ACh. 25 - Prob. 9ACh. 25 - Prob. 10ACh. 25 - Prob. 11ACh. 25 - Prob. 12ACh. 25 - Prob. 13ACh. 25 - Prob. 1TCCh. 25 - Prob. 2TCCh. 25 - Prob. 3TC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In a segment of DNA consisting of 1000 nitrogen bases, 28% of which are thymine, how many bases are adenine, guanine, and cytosine?arrow_forwardThe A and G compositions (mole percent) of one of the strands of a duplex DNA is A = 27 and G = 30. (a) What would be the T and C compositions of the complementary strand? (b) What can be said about the A and G compositions of its complementary strand?arrow_forwardIf the GC content of a DNA molecule is 60%, what are the molar percentages of the four bases (G, C, T, A)?arrow_forward
- The composition (in molefraction units) of one of the strands of a double-helical DNA molecule is [A] = 0.30 and [G] =0.24. (a) What can you say about [T] and [C] for the same strand? (b) What can you say about [A], [G], [T], and [C] of the complementary strand?arrow_forwardIf you analyze a double-stranded DNA molecule and find that 15% of all the nucleotide bases are Adenines, you know that there must also be [ Select ] Thymines, [ Select ] Guanines, [ Select ] v Cytosines and [ Select ] Uracils. (Count each of the bases in any double stranded DNA molecule and calculate their percentages to find the simple key for this if you haven't seen it yet.)arrow_forwardHow many possible nucleotide sequences are there for a stretch of DNA that is N nucleotides long, if it is (a) single- stranded or (b) double-stranded?arrow_forward
- Amino acids have an average molar mass of 100 g/mol.How many bases on a single strand of DNA are needed to codefor a protein with a molar mass of 5x10^5g/mol?arrow_forwardif this DNA has a molecular weight of 1.20 ×108 Dalton which contains a head in a about 200 nm long. Calculate the length of the DNA assuming the molecular weight of a nucleotide pair is 600 Dalton and assume that the DNA is a B-form and that there are 10 base pair per turn which makes is 34 Å per turn. ( 1nm = 10Å)arrow_forwardThe DNA chromosome in E. coli contains approximately 4 million base pairs. The average gene contains about 1500 base pairs. Use this information to calculate the following (show all work ): a) The length in meters of this chromosome. b) The approximate number of genes in the chromosome (assuming no wasted DNA).arrow_forward
- According to Chargaff's rule of nitrogenous base pairing, which of the following statements is correct? If all adenine bonds to thymine and all cytosine pairs with guanine, then the sum of all adenine will never be equal to the sum of all thymine in a DNA molecule. If all adenine bonds to thymine and all cytosine pairs with guanine, then the sum of all adenine will never be equal to the sum of all thymine in an RNA molecule. If all adenine bonds to thymine and all cytosine pairs with guanine, then the sum of all adenine equals the sum of all thymine in a DNA molecule. If all adenine bonds to uracil and all cytosine pairs with guanine, then the sum of all adenine will never be equal to the sum of all uracil in an RNA molecule.arrow_forwardIf the ratio (A+G)/(T+ C) in one strand of DNA is 0.3, what is the same ratio in the complementary strand?arrow_forwardThe Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY