
Laboratory Manual for Anatomy and Physiology, 6e Loose-Leaf Print Companion with WileyPLUS Blackboard Card Set
6th Edition
ISBN: 9781119425861
Author: Allen
Publisher: WILEY
expand_more
expand_more
format_list_bulleted
Question
Chapter 25, Problem 1.1BGL
Summary Introduction
To label: The major endocrine glands in the given figure.
Introduction: The endocrine system is the collection of the endocrine glands. There are two types of glands found in the human body, namely endocrine or ductless glands and exocrine or duct glands. The secretions of the endocrine glands are called hormones. They are secreted directly into the bloodstream and are found to regulate the metabolisms of the body. The endocrine system is under the control of the hypothalamus.
Expert Solution & Answer

Answer to Problem 1.1BGL
Pictorial representation:
Fig.1: Major endocrine glands
Explanation of Solution
- 1. Hypothalamus: It is located in the brain below the thalamus and acts as a control center that connects the functions of the nervous system with the endocrine system. It regulates the secretion of the anterior pituitary gland. The hypothalamus is extended to form the posterior pituitary.
- 2. Pituitary gland: It is situated at the base of the brain. The pituitary gland is divided into anterior (adenohypophysis) and posterior pituitary (neurohypophysis). The secretions of the anterior pituitary gland are called tropic hormones, which stimulate the secretion of other endocrine glands.
- 3. Pineal gland: It is a small gland located in the brain. It is also called conarium or epiphysis cerebri. The secretion of the pineal gland is called melatonin, a serotonin-derived hormone, which regulates the sleep cycle.
- 4. Thyroid gland: The thyroid gland is located at the base of the neck (below Adam’s apple). It is a butterfly-shaped organ having two lobes (left and right) connected by an isthmus. The thyroid gland secretes triiodothyronine (T3), thyroxine (T4), and calcitonin. Thyroid hormones regulate the
metabolism of body. - 5. Parathyroid glands: The parathyroid glands are found in the neck region behind the thyroid gland. There are four parathyroid glands, each pair located above (superior parathyroid glands) and below (inferior parathyroid glands). The parathyroid glands secrete parathyroid hormone (PTH).
- 6. Thymus gland: The thymus gland is located in the area between the lungs behind the sternum. It secretes thymosin, which induces the development of T lymphocytes, which plays a major role in the immune system.
- 7. Adrenal glands: They are triangular-shaped glands and are called suprarenal glands since they are found on the top of the renal system. The adrenal gland is divided into two portions, adrenal cortex, and adrenal medulla. Hormones secreted by adrenal glands play a role in regulating metabolism, stress, immune system, and blood pressure by maintaining the salt level in blood.
- 8. Pancreas: The pancreas is a dual or heterocrine gland, which secretes hormones (endocrine) and enzymes (exocrine). It is located behind the stomach as a long flattened gland. The main function of the pancreas is to regulate the blood glucose level.
- 9. Ovaries: Ovaries are the part of the female reproductive system situated along the left and right side of the uterus. At puberty, ovaries secrete hormones, namely estrogen, testosterone, progesterone, and inhibin. These hormones play a vital role in menstruation and fertility.
- 10. Testes: Testes are the male reproductive gland located within the scrotum. Testes secrete hormones like androgens. Testosterone is the primary androgen produced by the testes. The main function of testes is the production of sperm.
Want to see more full solutions like this?
Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 25 Solutions
Laboratory Manual for Anatomy and Physiology, 6e Loose-Leaf Print Companion with WileyPLUS Blackboard Card Set
Ch. 25 - Prob. 1.1BGLCh. 25 - Label the drawing and photomicrographs of the...Ch. 25 - Prob. 3.1BGLCh. 25 - Label the photomicrographs of the sections of...Ch. 25 - Observe the location of the adrenal glands in the...Ch. 25 - Label the terms in Figure 25.6(a), (b), and...Ch. 25 - Observe the location of the pancreas in the...Ch. 25 - Label the structures on the drawing in Figure...Ch. 25 - Using the labeled line drawing in Figure 25.8(b),...Ch. 25 - ACTH ________________________________
Ch. 25 - ADH ________________________________
Ch. 25 - Prob. 4HACh. 25 - Prob. 5HACh. 25 - LH ________________________________
Ch. 25 - Prob. 7HACh. 25 - Prob. 8HACh. 25 - Prob. 9HACh. 25 - PTH ________________________________
Ch. 25 - T3 ________________________________
Ch. 25 - T4 ________________________________
Ch. 25 - Prob. 13HACh. 25 - MSH ________________________________
Ch. 25 - TH ________________________________
Ch. 25 - ACTH ____________________
Ch. 25 - ADH ____________________
Ch. 25 - aldosterone ____________________
Ch. 25 - Prob. 4MEGHCh. 25 - calcitonin ____________________
Ch. 25 - Prob. 6MEGHCh. 25 - epinephrine/NE ____________________
Ch. 25 - estrogen; progesterone ____________________
Ch. 25 - FSH ____________________
Ch. 25 - Prob. 10MEGHCh. 25 - Prob. 11MEGHCh. 25 - Prob. 12MEGHCh. 25 - Prob. 13MEGHCh. 25 - Prob. 14MEGHCh. 25 - Prob. 15MEGHCh. 25 - Prob. 16MEGHCh. 25 - Prob. 17MEGHCh. 25 - Prob. 18MEGHCh. 25 - Prob. 19MEGHCh. 25 - Prob. 20MEGHCh. 25 - Prob. 21MEGHCh. 25 - Prob. 22MEGHCh. 25 - _______ Stimulates uterine contractions and milk...Ch. 25 - Prob. 2HFCh. 25 - Prob. 3HFCh. 25 - Prob. 4HFCh. 25 - Prob. 5HFCh. 25 - Prob. 6HFCh. 25 - Prob. 7HFCh. 25 - Prob. 8HFCh. 25 - Prob. 9HFCh. 25 - Prob. 10HFCh. 25 - Prob. 11HFCh. 25 - Prob. 12HFCh. 25 - _______________ Helps to set the biological...Ch. 25 - Prob. 14HFCh. 25 - Prob. 15HFCh. 25 - Prob. 16HFCh. 25 - _______________ Promotes the maturation of T cells...Ch. 25 - Prob. 18HFCh. 25 - Prob. 19HFCh. 25 - Prob. 20HFCh. 25 - Prob. 21HFCh. 25 - Prob. 22HFCh. 25 - Prob. 23HFCh. 25 - Prob. 24HFCh. 25 - Prob. 25HFCh. 25 - Prob. 26HFCh. 25 - Prob. 27HFCh. 25 - Prob. 1ESSCh. 25 - Prob. 2ESSCh. 25 - Prob. 3ESSCh. 25 - Prob. 4ESSCh. 25 - Prob. 5ESSCh. 25 - Prob. 6ESSCh. 25 - Prob. 7ESSCh. 25 - Prob. 8ESSCh. 25 - Prob. 9ESSCh. 25 - Prob. 10ESSCh. 25 - Prob. 1UYKCh. 25 - Prob. 2UYKCh. 25 - Prob. 3UYKCh. 25 - Using your textbook or another reference book,...Ch. 25 - Prob. 5UYKCh. 25 - Prob. 6UYKCh. 25 - Prob. 7UYKCh. 25 - Prob. 8UYKCh. 25 - Prob. 9UYKCh. 25 - Prob. 10UYKCh. 25 - Prob. 11UYKCh. 25 - Prob. 12UYKCh. 25 -
Hypothalamus and tropic hormones.
Ch. 25 - Prob. 14UYKCh. 25 - Prob. 15UYKCh. 25 - Prob. 16UYKCh. 25 - Prob. 17UYKCh. 25 - Prob. 18UYKCh. 25 - Prob. 19UYKCh. 25 - Prob. 20UYK
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Great Glands - Your Endocrine System: CrashCourse Biology #33; Author: CrashCourse;https://www.youtube.com/watch?v=WVrlHH14q3o;License: Standard Youtube License