Campbell Biology
12th Edition
ISBN: 9780135188743
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 21.3, Problem 1CC
The best estimate is that the human genome contains fewer than 21,000 genes. However, there is evidence that human cells produce many more than 21,000 differ- ent Polypeptides. What processes might account for this discrepancy?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A 2500 bp region of the human genome encodes two genes. One of the genes encodes a protein of 600 amino acids and the other gene encodes a protein of 280 amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences (i.e. they do not overlap). How is this possible? Fully explain your answer.
The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?
People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA sequence.People who carry this genetic disorder have a single nucleotide polymorphism that results in a change of GTATTC to GGATTC, a site that only occurs once at nucleotide number 750 in this DNA sequence. Answer the following questions based on the information provided.
(a) How can you develop a simple molecular test to identify the genetic disorder?
(b) If you have carried out the molecular test (based on the information above) on a 100 individual and found that 24 were healthy (BB) and 26 were carriers (bb); 1) What is the ratio of heterozygous? 2) Show how can you identify the three types from the agarose gel
Chapter 21 Solutions
Campbell Biology
Ch. 21.1 - Describe the whole-genome shotgun approach.Ch. 21.2 - Prob. 1CCCh. 21.2 - Explain the advantage of the systems biology...Ch. 21.2 - Prob. 3CCCh. 21.2 - MAKE CONNECTIONS In Concept 20.2, you learned...Ch. 21.3 - The best estimate is that the human genome...Ch. 21.3 - The Genomes Online Database (GOLD) Website of the...Ch. 21.3 - WHAT IF? What evolutionary processes might...Ch. 21.4 - Discuss the characteristics of mammalian genomes...Ch. 21.4 - VISUAL SKILLS Which of the three mechanisms...
Ch. 21.4 - Contrast the organizations of the rRNA gene family...Ch. 21.4 - MAKE CONNECTIONS Assign each DNA segment at the...Ch. 21.5 - Describe three examples of errors in cellular...Ch. 21.5 - Explain how multiple exons might have arisen in...Ch. 21.5 - What are three ways that transposable elements are...Ch. 21.5 - WHAT IF? In 2005, Icelandic scientists reported...Ch. 21.6 - Prob. 1CCCh. 21.6 - Prob. 2CCCh. 21.6 - Prob. 3CCCh. 21 - How did the Human Genome Project result in more...Ch. 21 - What has been the most significant finding of the...Ch. 21 - Compare genome size, gene number, and gene density...Ch. 21 - Explain how the function of transposable elements...Ch. 21 - How could chromosomal rearrangements lead to the...Ch. 21 - What type of Information can be obtained by...Ch. 21 - Bioinformatics intludes all of the following...Ch. 21 - Homeotic genes (A) encode transcription factors...Ch. 21 - Prob. 3TYUCh. 21 - DRAW IT Below are the amino acid sequences(using...Ch. 21 - EVOLUTION CONNECTION Genes important in the...Ch. 21 - scientific inquiry The scientists mapping the SNPs...Ch. 21 - Prob. 7TYUCh. 21 - SYNTHESIZE YOUR KNOWLEDGE Insects have three...
Additional Science Textbook Solutions
Find more solutions based on key concepts
What is the pH range for acidic solutions? For basic solutions?
EBK INTRODUCTION TO CHEMISTRY
An aluminum calorimeter with a mass of 100 g contains 250 g of water. The calorimeter and water are in thermal ...
Physics for Scientists and Engineers
True or false? Some trails are considered vestigial because they existed long ago.
Biological Science (6th Edition)
Single penny tossed 20 times and counting heads and tails: Probability (prediction): _______/20 heads ________/...
Laboratory Manual For Human Anatomy & Physiology
Identify me theme or themes exemplified by (a) the sharp quills of a porcupine (b) the development of a multice...
Campbell Biology in Focus (2nd Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA sequence. People who carry this genetic disorder have a single nucleotide polymorphism that results in a change of GTATTC to GGATTC, a site that only occurs once at nucleotide number 750 in this DNA sequence. Answer the following questions based on the information provided. (a) How can you develop a simple molecular test to identify the genetic disorder? (b) If you have carried out the molecular test (based on the information above) on a 100 individuals and found that 24 were healthy (BB) and 26 were carriers (bb); 1) What is the ratio of heterozygous? 2) Show how can you identify the three types from the agarose gel.arrow_forwardPeople who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA sequence. People who carry this genetic disorder have a single nucleotide polymorphism that results in a change of GTATTC to GGATTC, a site that only occurs once at nucleotide number 750 in this DNA sequence. Answer the following questions based on the information provided. (a) How can you develop a simple molecular test to identify the genetic disorder? (b) If you have carried out the molecular test (based on the information above) on a 100 individual and found that 24 were healthy (BB) and 26 were carriers (bb); 1) What is the ratio of heterozygous? 2) Show how can you identify the three types from the agarose gelarrow_forwardE. How many nucleotides would be required to generate a polypeptide that is 15 amino acids long? This requires knowing how many nucleotides of DNA code for one amino acid. F. Assuming that there are between 20,000-25,000 genes in the human genome, do you think there are 1) fewer, 2) approximately the same number, or 3) more proteins in the human genome? Explain your answer.arrow_forward
- People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA sequence. People who carry this genetic disorder have a single nucleotide polymorphism that results in a change of GTATCC to GGATCC, a site that only occurs once at nucleotide number 750 in this DNA sequence. Answer the following questions based on the information provided. (a) How can you develop a simple molecular test to identify the genetic disorder?r B-dif w. (41 (b) If you have carried out the molecular test (based on the information above) on a 100 individual and found that 24 were healthy (BB) and 26 were carriers (bb); 1) What is the ratio of heterozygous? 2) Show how can you identify the three types from the agarose gel (H focaiarrow_forwardGiven that there are about 20,000 human genes, how can human cells make 75,00o-100,000 different proteins? Distinguish between missense and nonsense. Compare and contrast between insertions and deletions. Why are these called “frameshift” mutations? What are thymine dimers? What causes them?arrow_forwardAnnotation of the human genome sequence reveals a discrepancy between the number of protein-coding genes and the number of predicted proteins actually expressed by the genome. Proteomic analysis indicates that human cells are capable of synthesizing more than 100,000 different proteins and perhaps three times this number. What is the discrepancy, and how can it be reconciled?arrow_forward
- Although DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements usually make up the largest fraction of very large genomes such as those from humans (~2500 Mb), maize (~2500 Mb), and barley (~5000 Mb). Given what you know about class 1 and class 2 elements, what is it about their distinct mechanisms of transposition that would account for this consistent difference in abundance?arrow_forwardWhat percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?arrow_forwardWhen the human genome sequence was finally completed, scientists were surprised to discover that the genome contains far fewer genes than expected. How many genes are present in the human genome? Scientists have also found that there are many more different kinds of proteins in human cells than there are different genes in the genome. How can this be explained?arrow_forward
- The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to random chance, how often would you expect this sequence to occur in the human genome, which contains approximately 3 billion base pairs? Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen gene Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen genearrow_forwardYour advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?arrow_forwardA 210-bp sequence within the CFTR gene on human chromosome 7 is shown below. The three bold underlined nucleotides are deleted in a common cystic fibrosis (CF) mutation, removing a phenylalanine amino acid from the CFTR protein. 1 AGAGGGTAAA ATTAAGCACA GTGGAAGAAT TTCATTCTGT TCTCAGTTTT 51 CCTGGATTAT GCCTGGCACC ATTAAAGAAA ATATCATCTT TGGTGTTTCC 101 TATGATGAAT ATAGATACAG AAGCGTCATC AAAGCATGCC AACTAGAAGA 151 GGTAAGAAAC TATGTGAAAA CTTTTTGATT ATGCATATGA ACCCTTCACA 201 CTACCCAAAT PCR primers have been designed to amplify fragments within this sequence: Forward: GGATTATGCCTGGCACCATT Reverse: AGTGTGAAGGGTTCATATGC DNA from a CF patient is tested with a PCR assay using a pair of these primers, and the PCR product is found to be 3 bp shorter than that expected from the sequence shown above. What length PCR products (in bp) would you expect in the mother of the CF patient? A. 95 and 92 B. 149 C. 133 and 130 D. 149 and 146 E. 146arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License