Biological Science (6th Edition)
6th Edition
ISBN: 9780321976499
Author: Scott Freeman, Kim Quillin, Lizabeth Allison, Michael Black, Emily Taylor, Greg Podgorski, Jeff Carmichael
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 21, Problem 9TYPSS
QUANTITATIVE Imagine a situation in which a morphogen has its source at the posterior end of a Drosophila embryo. Every 100 um from the posterior pole, the morphogen concentration decreases by half. If a cell required l/16th the amount of morphogen found at the posterior pole to form part of a leg, how far from the posterior pole would the leg form?
a. 100 μm
b. 160 μm
c. 400 μm
d. 1600 μm
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What property prevents the ligands of cell-surface receptors from entering the cell? a. The molecules bind to the extracellular domain. b. The molecules are hydrophilic and cannot penetrate the hydrophobic interior of the plasma membrane. c. The molecules are attached to transport proteins that deliver them through the bloodstream to target cells. d. The ligands are able to penetrate the membrane and directly influence gene expression upon receptor binding.
You are studying a protein that you observe to be located in the ER and Golgi. You hypothesize that this protein is an ER resident protein. How would you go about testing your hypothesis?
A. Increase the pH of the Golgi and see if the protein is secreted from the cell.
B. All are experiments that will address the question.
O C. Look for and remove KDEL sequence and look to see if the protein is present in the ER.
Đ. Look for and remove KDEL sequence and look to see if the protein is secreted from cell.
Which of these is NOT true of nucleosomes?
A. Some post-translational modifications to histone proteins serve as binding sites for transcription factors.
B. The position of nucleosomes is fixed on the genome and can not be changed.
C. The position and post-translational modifications of histones can be inherited through mitosis.
D. The binding between DNA and histone proteins can be disrupted by post-translational modifications.
Chapter 21 Solutions
Biological Science (6th Edition)
Ch. 21 - 1. What is apoptosis?
a. an experimental technique...Ch. 21 - In adult animals, ______ are a source of...Ch. 21 - 3. What is a homeotic mutant?
a. an individual...Ch. 21 - 4. A tool-kit gene is _________.
Ch. 21 - CAUTION A friend is interested in isolating genes...Ch. 21 - 6. How is determination distinct from...Ch. 21 - What is the connection between genetic regulatory...Ch. 21 - Which of the following provides the strongest...Ch. 21 - QUANTITATIVE Imagine a situation in which a...Ch. 21 - 10. PROCESS OF SCIENCE Some stickleback fish...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You are investigating the transport of proteins into the ER in various mutant cells. Where would you expect to find ER proteins in a cell in which the gene encoding TOM proteins have been knocked out? a. Proteasome b. Cytoplasm c. Mitochondria d. nucleus e. ERarrow_forwardSignal transduction pathways are important mechanisms for cell-to-cell communication in multicellular organisms. How do the target cells typically respond when they receive signals from neighboring cells during very early stages of embryo development? A. The target cells move to one of the poles to establish the anterior-posterior body axis. B. The target cells undergo changes in gene expression, sending them down a specific developmental path. C. The target cells stop dividing so the neighboring cells have time to get to the same stage of development. D. The target cells activate a collection of miRNAs to accelerate transcription and cell division.arrow_forwardFor the Igf2 gene, where do de novo methylation and maintenancemethylation occur?a. De novo methylation occurs in sperm, and maintenancemethylation occurs in egg cells.b. De novo methylation occurs in egg cells, and maintenancemethylation occurs in sperm cells.c. De novo methylation occurs in sperm, and maintenancemethylation occurs in somatic cells of offspring.d. De novo methylation occurs in egg cells, and maintenancemethylation occurs in somatic cells of offspring.arrow_forward
- After the initial Actualization of the Cit+ phenotype, there was another alteration to the A-3 genome that resulted in increased growth (e.g. Refinement). What explained the increase in growth rate in response to Refinement? A. Increase number of transporters localized to the plasma membrane. B. Increased ability to metabolize glucose. C. Increased citric acid cycle activity. D. Altered promoter activity resulting in constitutive gene expression.arrow_forwardWhich of the following correctly explains how gene expression can change in a differentiating cell in an animal embryo?A. DNA methylation triggered by apoptosis leads to suppression of some genes and expression of others.B. Presence of germ layers trigger hormonal release from endocrine glands, signaling to certain cells to express genes.C. Cell signals through plasmodesmata allow coordination of cellular activities and cell differentiation.D. Cues from the cytoplasm and from surrounding cells can induce changes in gene expression.arrow_forwardWhat is an induced pluripotent stem cell? a. A cell from which the nucleus has been removed b. A cell extracted from an early embryo c. A specially treated somatic cell that can develop into any cell type d. A specially treated embryonic stem cell that develops into one specialized cell typearrow_forward
- Draw a diagram to illustrate how a concentration gradient of a transcription factor along the anterior-posterior axis of a Drosophila embryo can create a region in the middle in which transcription of a target gene takes place without being transcribed in either the anterior or posterior region.arrow_forwardThe NFAT family is a ubiquitous family of transcription factors. a. Under resting conditions, where is NFAT localized in a cell? b. Under activated conditions, where is NFAT localized in a cell? c. How is it released from its resting condition and permitted to relocalize? d. Immunosuppressant drugs such as cyclosporin act via inhibition of the calcineurin phosphatase. If NFAT is ubiqitous, how do you think these drugs might act with so few side effects on other signaling processes within the body?arrow_forwardHow is the expression of genes controlled at the chromosomal level? A. DNA can synthesize extra histones as needed B. DNA can either be condensed into heterochromatin or decondensed into euchromatin C. DNA can be unwound into euchromatin to reduce the level of expression D. The expression of DNA can only be controlled at the transcriptional level E. DNA is spontaneously deleted from a chromosome if not neededarrow_forward
- Why is regulating transcription the main way that cells control gene expression? A. Because transcription is the last step in gene expression, stopping here ensures that the cell has a stockpile of proteins to prepare them from all unexpected environmental changes. B. Because transcription involves interactions with DNA, preventing transcription reduces the changes of mutation in the cell’s genome. C. Because transcription is the first step in gene expression, stopping at transcription reduces the amount of energy and resources used by producing unnecessary gene products. D. Because transcription is the shortest step in gene expression, preventing transcription has little effect on the rate of protein production.arrow_forwardWhat is the difference between cyclins and kinase proteins? A. Kinases regulates MPF dimer formation and cyclins phosphorylates the kinases in a negative feedback loop B. Cyclins regulate cell cycle, while kinases are enzymes that catalyze phosphorylation of cyclins C. Kinases are enzymes that convert MPF into CDK and the cyclins bind to CDK to send cells into M phase D. Cyclins are enzymes and kinase are proteins that regulate M phasearrow_forwardWhich statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repairarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY