Campbell Biology (11th Edition)
11th Edition
ISBN: 9780134093413
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 21, Problem 4TYU
DRAW IT Below are the amino acid sequences(using the single-letter code; see Figure 5.14) of four short segments of the FOXP2 protein from six Speeles: chimpanzce (Q, orangutan (()), gorllla (G), rhesus macaque (R), mouse (M), and human (H). These segments contain all of the amino acid differences helween the FOXP2 proteinsof these species.
Use a highlighter to color anv amino acid that varies among the species. (Color that amino acid in all sequences.
- (a) The C, G, R sequences are identical. Identily which lines correspond to those sequences.
- (b) The O sequence differs from the C, G, R speieces at two amino acids. Underilnethetwodlffcrences inthe H sequence.
- (c) The O sequence diffen from the C, G, R sequences at one amino acid (having V instead of A) and from the H sequence at three amino acids. Identify tho O sequence.
- (d) In the M sequence,circle the amino acid(s) that differ from the C, G, R sequence, and draw a square around those that differ from the H sequence.
- (e) Primates and rodents diverged between 60 and IO0 million years ago. and chimpanzees and humans about 6 million years ago. Compare the amino acid differences between the mouse and the C, G, R species with those between the human and the C, G, R species. What can you conclude?
Expert Solution & Answer
Learn your wayIncludes step-by-step video
schedule09:19
Students have asked these similar questions
A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new protein with high similarity to the lysylphosphatidylglycerol flippase enzyme. A short section of the new protein sequence is shown below. TVEVNAPGDVQKALSELQQINDGRLDIRI (a) Are any reverse turns likely to be present? Explain your answer. (b) Are any beta-strands likely to be present? Explain your answer. (c) Are any alpha helices likely to be present? Explain your answer. (d) Is any supersecondary structure likely to be present? Explain your answer. (e) Identify two residues that are likely to be buried in the core of the folded protein. Explain your answer. (f) Identify two residues that are likely to be hydrogen bonded to each other. Explain your answer.
Take a look at the multiple-sequence alignment shown ofthe globin polypeptides, focusing on amino acids 101 to 148.A. Which of these amino acids are likely to be most important forglobin structure and function? Explain why.B. Which are likely to be least important?
Construct a multiple protein sequence alignment using human HOXD13 and 9
other orthologues of human HOXD13. In the figure legend, describe what is being
shown, and specify the size (start and stop number of amino acid) and location of
conserved domain(s) in HOXD13
level: UNI
Chapter 21 Solutions
Campbell Biology (11th Edition)
Ch. 21.1 - Describe the whole-genome shotgun approach.Ch. 21.2 - Prob. 1CCCh. 21.2 - Explain the advantage of the systems biology...Ch. 21.2 - MAKE CONNECTIONS The ENCODE pilot project found...Ch. 21.2 - MAKE CONNECTIONS In Concept 20.2, you learned...Ch. 21.3 - The best estimate is that the human genome...Ch. 21.3 - The Genomes Online Database (GOLD) Website of the...Ch. 21.3 - WHAT IF? What evolutionary processes might...Ch. 21.4 - Discuss the characteristics of mammalian genomes...Ch. 21.4 - VISUAL SKILLS Which of the three mechanisms...
Ch. 21.4 - Contrast the organizations of the rRNA gene family...Ch. 21.4 - MAKE CONNECTIONS Assign each DNA segment at the...Ch. 21.5 - Describe three examples of errors in cellular...Ch. 21.5 - Explain how multiple exons might have arisen in...Ch. 21.5 - What are three ways that transposable elements are...Ch. 21.5 - WHAT IF? In 2005, Icelandic scientists reported...Ch. 21 - How did the Human Genome Project result in more...Ch. 21 - What has been the most significant finding of the...Ch. 21 - Compare genome size, gene number, and gene density...Ch. 21 - Explain how the function of transposable elements...Ch. 21 - How could chromosomal rearrangements lead to the...Ch. 21 - What type of Information can be obtained by...Ch. 21 - Bioinformatics intludes all of the following...Ch. 21 - Homeotic genes (A) encode transcription factors...Ch. 21 - Prob. 3TYUCh. 21 - DRAW IT Below are the amino acid sequences(using...Ch. 21 - EVOLUTION CONNECTION Genes important in the...Ch. 21 - scientific inquiry The scientists mapping the SNPs...Ch. 21 - Prob. 7TYUCh. 21 - SYNTHESIZE YOUR KNOWLEDGE Insects have three...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Explain all answers clearly, with complete sentences and proper essay structure if needed. An asterisk (*) desi...
Cosmic Perspective Fundamentals
27. Consider the reaction.
Express the rate of the reaction in terms of the change in concentration of each of...
Chemistry: Structure and Properties (2nd Edition)
Two culture media were inoculated with four different bacteria. After incubation, the following results were ob...
Microbiology: An Introduction
Which one of the following is not a fuel produced by microorganisms? a. algal oil b. ethanol c. hydrogen d. met...
Microbiology: An Introduction
95. What is the minimum amount of necessary to produce 15.0 g of according to the reaction:
...
Introductory Chemistry (6th Edition)
Johnny was vigorously exercising the only joints in the skull that are freely movable. What would you guess he ...
Anatomy & Physiology (6th Edition)
Knowledge Booster
Similar questions
- What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. provide calculationarrow_forwardYou have discovered a novel protein that has a pl = 5.5. To study the functional properties of this new protein your research group has made a mutant that contains two amino acid changes-namely, a surface Phe residue in the normal protein has been replace by His (side chain pk = 6.1), and a surface Gln has been replace by Glu (side chain pk. = 6.0). The pl of the mutant protein is predicted to be: A. Greater than the pl of the normal protein. B. Less than the pl of the normal protein. C. The same as the pl of the normal protein.arrow_forwardIn a folded protein, Glu116 is close in three-dimensional space to Lys224. The pKa of the carboxylic acid functional group in the side chain of glutamic acid is 4.3. The pKa of the amino group in the side chain of lysine is 10.5. How do you think the pKa of the side chain of Glu116 will change in the folded protein? a. The pKa will be > 4.3. b. The pKa will be < 4.3. c. The pKa will not change. Use chemical reasoning to justify your answer.arrow_forward
- A hypothetical protein found in humans, chimpanzees, and orangutans has the following sequences. Underlining indicates amino acid residue differences and dashes indicate a deletion. Humans ATSAAGYDEWEGGKYLIHL--KLQNRGALLELDIGAV ATSAAGWDEWEGGKILIHLDGKLQNRGALLELDIGAV ATSAAGWDEWEGGKVLIHLDGKLQNRGALLELDIGAV Chimpanzees Orangutans What is the sequence of the protein present in the last common ancestor of humans and chimpanzees? sequence: ATSAAGWDEWEGGKVLIHILDGKLQNRGALIELDIGAV Incorrect Answerarrow_forwardAlthough the Shine-Dalgarno sequences vary considerably in differ- ent genes, they include examples like GAGGGG that could serve as code-in this case, for Glu-Gly. Does this imply that the sequence Glu-Gly cannot ever occur in a protein, lest it be read as a Shine-Dalgarno sequence? Speculate.arrow_forwardThe following steps were performed using enzyme cleavage of a peptide to determine its amino acid sequence. Step 1. FDNB yield DNB-Gly Step 2. Treatment with trypsin yield 3 fragments: Tyr-Leu-Asp-Arg; Gly-Ser-Ala-Lys; Trp-Gly-Ser-Met Step 3. Treatment with pepsin gave the same 3 peptide fragments. What is the sequence of the peptide?arrow_forwardA pentapeptide was found to increase the rate of hydrolysis of fats in the adipose tissues to provide fatty acids as sources of energy. The amino acid sequence of this peptide was determined to be: ALA-ARG-LYS-MET-SER Hydrolysis of the three variants of the peptide, and analysis of their amino acid composition revealed the following changes: Variants Amino Acid Replacement Peptide 1 Arg was replaced by Leu Peptide 2 Ala was replaced by Tyr Peptide 3 Arg was replaced by Glu What will be the positions of these variant peptides compared with the normal peptide in an electrophoretic run at pH 7.0?arrow_forwardSickle cell anemia is caused by a point mutation in the β-globin chain of hemoglobin. Glutamic acid is replaced by Valine. HBB sequence in normal adult hemoglobin (Hb A): Leu-Thr-Pro-Glu-Glu-Lys-Ser HBB sequence in mutant adult hemoglobin (Hb S): Leu-Thr-Pro-Val-Glu-Lys-Ser What effect does this mutation have on the structure and function of the protein? Predict what would happen to the RBC if the glutamic acid was replaced with asparagine instead of valine.arrow_forwardA peptide with the primary structure Lys-Arg-Pro-Leu-Ile-Asp-Gly-Ala must be synthesized by the methods developed by Merrifield. Calculate the percentage of the peptides synthesized that will be full length and have the correct sequence if the addition of each amino acid residue is 96% efficient. Do the calculation a second time but assume a 99% efficiency for each cycle. full-length peptides with the correct sequence if 96% efficient: full-length peptides with the correct sequence if 99% efficient: % %arrow_forwardA peptide with 19 amino acid residues was digested with trypsin and generated the following fragments: • GGIR SFLG WAAPK AEEGLR A similar peptide was treated with chymotrypsin and generated the following fragments: • LG AEEGLRW AAPKGGIRSF Elucidate the correct sequence of the peptide.arrow_forwardShown to the right is a cartoon image of ETC Complex I from Y. lipolytica. A group of authors studied this wild type Complex I and also a version where the arginine at position 121 in the chain 3 subunit was mutated to a methionine (R121M). Part of chain 3 subunit contains the peptide sequence SMITH a. Draw the titration curve for the SMITH peptide. Mark all pKa’s and the pI on your curve. For the SMITH peptide at physiological pH, explain what types of interactions you believe the side chains are or are not able to participate in.arrow_forwardConsider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?arrow_forwardarrow_back_iosSEE MORE QUESTIONSarrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education