Human Biology Lab
15th Edition
ISBN: 9781308566672
Author: McGraw-Hill Education
Publisher: Mcgraw-Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 2.1, Problem 4LO
Summary Introduction
To distinguish:
In-between ionic and covalent bonds.
Introduction:
The atoms like sodium and chloride form ionic bond when the electrons in the outer shell give and take electrons to achieve a stable state of eight electrons in the valence shell of the atom. The sodium atom in an ionized state has a positive charge and the chlorine atom in an ionized state has a negative charge. The covalent bond is formed by the sharing of the electrons in the outer shell orbital of the atoms. The electrons are stable in this state.
Pictorial representation:
The ionic and covalent bonding is well represented in the Fig.1.
Fig.1: Ionic bonding and Covalent bonding
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 2 Solutions
Human Biology Lab
Ch. 2.1 - Prob. 1LOCh. 2.1 - 2. Describe the structure of an atom.
Ch. 2.1 - Prob. 3LOCh. 2.1 - 4. Distinguish between ionic and covalent bonds.
Ch. 2.2 - Describe the properties of water.Ch. 2.2 - Prob. 2LOCh. 2.2 - Prob. 3LOCh. 2.3 - List the four classes of organic molecules that...Ch. 2.3 - Describe the processes by which the organic...Ch. 2.4 - Prob. 1LO
Ch. 2.4 - Prob. 2LOCh. 2.4 - Prob. 3LOCh. 2.4 - Prob. 4LOCh. 2.4 - Prob. 1BTHCh. 2.4 - Prob. 2BTHCh. 2.5 - Prob. 1LOCh. 2.5 - Prob. 2LOCh. 2.5 - Why might physicians resort to calling HDLs and...Ch. 2.5 - Prob. 2BTHCh. 2.6 - Prob. 1LOCh. 2.6 - Prob. 2LOCh. 2.6 - List the four levels of protein structure and...Ch. 2.7 - Prob. 1LOCh. 2.7 - Prob. 2LOCh. 2 - Prob. 1ACh. 2 - Prob. 2ACh. 2 - Prob. 3ACh. 2 - Prob. 4ACh. 2 - Prob. 5ACh. 2 - Prob. 6ACh. 2 - Prob. 7ACh. 2 - Prob. 8ACh. 2 - Prob. 9ACh. 2 - Prob. 10ACh. 2 - Prob. 11ACh. 2 - Prob. 12ACh. 2 - Prob. 13ACh. 2 - Prob. 14ACh. 2 - Prob. 15ACh. 2 - Prob. 16ACh. 2 - Prob. 17ACh. 2 - Prob. 18ACh. 2 - Prob. 19ACh. 2 - This nucleic acid is typically involved in energy...Ch. 2 - Prob. 1TCCh. 2 - Prob. 2TCCh. 2 - Name another substance that is needed in the body...Ch. 2 - Prob. 4TCCh. 2 - Prob. 5TC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license