Introduction:
The arteries of the human body play an important role in transporting oxygenated blood to the body parts. The direction of oxygenated blood transfer is generally away from the heart and out to body tissues and organs.

Answer to Problem 1RAC
The correct answer is option (b) 3,4,1,2,6,5.
Explanation of Solution
Explanation for the correct answer:
Option (b) 3,4,1,2,6,5. After leaving the heart, oxygenated blood enters elastic arteries. The elastic arteries are composed of various smooth muscle cells. Thus, the oxygenated blood then proceeds through the muscular arteries. The muscular arteries branch out into various smaller arteries. These arteries are referred to as arterioles. The blood travels through the arterioles and then reaches capillaries. The blood gives oxygen to the body tissues in the capillaries. Then the blood enters the venules, and after that, the blood travels through the large veins and at final, reenters the heart. So, the correct answer is option (b).
Explanation for incorrect answer:
Option (a) 3,4,2,1,5,6. The oxygenated blood after leaving the heart enters into elastic arteries and then travels through the muscular arteries and not arterioles. So, this is an incorrect option.
Option (c) 4,3,1,2,5,6. Initially, the oxygenated blood after leaving the heart travels through the elastic arteries and not muscular arteries. So, this is an incorrect option.
Option (d) 4,3,2,1,6,5. After leaving the heart, blood travels through elastic arteries and then enters into muscular arteries. So, this is an incorrect option.
Option (e) 4,2,3,5,1,6. The oxygenated blood initially enters into elastic arteries and then enters into muscular arteries and not capillaries. So, this is an incorrect option.
The direction of blood flow is from the heart to elastic arteries, then muscular arteries, after that enters into arterioles, travels through capillaries, after that enters into venules. The blood reenters the heart after traveling through veins. Hence, the correct answer is option (b) 3,4,1,2,6,5.
Want to see more full solutions like this?
Chapter 21 Solutions
Seeley's Anatomy & Physiology
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning


