Biological Science (7th Edition)
7th Edition
ISBN: 9780134678320
Author: Scott Freeman, Kim Quillin, Lizabeth Allison, Michael Black, Greg Podgorski, Emily Taylor, Jeff Carmichael
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 21, Problem 10TYPSS
PROCESS OF SCIENCE Some stickleback fish develop protective spines, and other stickleback fish are spineless. Spine development is controlled by the expression of a gene known as Pitxl. The spineless
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model.
You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos?
You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA?
5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’
3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’
After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…
given a situation in which you manipulated a zebrafish embryo by injecting high levels of retinoic acid so that no anterior genes will be expressed. Surprisingly, after embryonic development, you are still able to observed the presence of anterior structures. What could explain this observation? What changes in your experiment would you make to achieve your objective?
Please answer question 11
Chapter 21 Solutions
Biological Science (7th Edition)
Ch. 21 - 1. What is apoptosis?
a. an experimental technique...Ch. 21 - In adult animals, ______ are a source of...Ch. 21 - 3. What is a homeotic mutant?
a. an individual...Ch. 21 - 4. A tool-kit gene is _________.
Ch. 21 - What is the connection between genetic regulatory...Ch. 21 - Which of the following provides the strongest...Ch. 21 - QUANTITATIVE Imagine a situation in which a...Ch. 21 - 10. PROCESS OF SCIENCE Some stickleback fish...Ch. 21 - Will iPS cells be the cure for diabetes?
Type I...Ch. 21 - 12. If researchers were attempting to stimulate...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- At the molecular level, how do you think a gain-of-function mutation in a developmental gene might cause it to be expressed in the wrong place or at the wrong time? Explain what type of DNA sequence would be altered.arrow_forwardDescribe experimental evidence that would indicate that most or nearly all of the DNA sequences in a mammalian genome are transcribed.arrow_forwardAnother way to study the role of proteins (e.g., transcription factors) that function in development is to microinject the mRNA that encodes a protein, or the purified protein itself, into an oocyte or embryo, and then determine how this affects the subsequent development of the embryo, larva, and adult. For example, if Bicoid protein is injected into the posterior region of an oocyte, the resulting embryo will develop into a larva that has anterior structures at both ends. Based on your understanding of the function of each developmental gene, what would be the predicted phenotype if the following proteins or mRNAs were injected into normal oocytes? A. Nanos mRNA injected into the anterior end of an oocyte B. Antp protein injected into the posterior end of an embryo C. Toll mRNA injected into the dorsal side of an early embryoarrow_forward
- You are interested in finding out the function of a particular gene in the mouse genome. You have determined the nucleotide sequence of the gene, defined the portion that codes for its protein product, and searched the relevant database for similar sequences; however, neither the gene nor the encoded protein resembles anything previously described. What types of additional information about the gene and the encoded protein would you like to know in order to narrow down its function, and why?arrow_forwardDevelopmental genes are often highly conserved. However, organisms with very similar genes can appear quite different. How is this possible? A. The genes may usually undergo mutation during development, resulting in the production of varied proteins in individual cells. B. If an identical gene is turned on at different stages in development, it can have very different effects. C. Even if genes are quite similar, they always produce proteins with different functions. D. If the genes are very similar, they must always be expressed similarly (at similar times in development) but may sometimes still have varying effects.arrow_forwardYou are working in a lab that studies stickleback fish. These fish normally have three spines that occur on the back of the stickleback. One day you notice that a young stickleback has no spines on its back but instead has three spines growing out of the top of its head! Question: Briefly explain a study you could do to test if the difference between the mutant and wild type fish was due to a difference in the structural gene that makes the spines or due to a difference in gene expression.arrow_forward
- . Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNAarrow_forwardA Drosophila egg that is bed lbcd may develop normally, but the adult fruit fly will not be able to produce viable offspring. How is this possible? The mother can provide the bcd mRNA required for normal development, but the adult bcd /bcd female fly cannot make its own bcd mRNA. The Hox genes in the egg play a redundant role to bcd during development in a bcd / bcd egg, but reproduction requires bcd. Drosophila sperm contains the functional bcd gene product required for normal development, but the adult sex cells will not be able to produce the functional product. The nanos gene product functionally compensates for lack of bcd expression in the developing fly but not in its offspring.arrow_forwardExpression of recombinant proteins in yeast is an important tool for biotechnology companies that produce new drugs for human use. In an attempt to get a new gene X expressed in yeast, a researcher has integrated gene X into the yeast genome near a telomere. Will this strategy result in good expression of gene X? Why or why not? please try to explain a bit elaborately.arrow_forward
- Suppose that you have just graduated from college and have started working at a biotechnology firm. Your first job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig gene for prolactin has not yet been isolated, sequenced, or mapped; however, the mouse gene for prolactin has been cloned, and the amino acid sequence of mouse prolactin is known. Briefly explain two different strategies that you might use to find and clone the pig gene for prolactin.arrow_forwardYou discover that zebrafish contain a gene that has a similar sequence to Drosophila abdoless. Describe TWO experiments you would do to test for a similar function.arrow_forwardYou are working with a fly hair cell developmental system. This Notch/Delta-regulated system results in clusters of cells where the central one differentiates into a specialized hair cell. To better understand this system you have tagged the C-terminal cytoplasmic domain of Notch with GFP. You have done a forward genetic screen to look for mutants that have unusual phenotypes in this Notch system. The first one is a mutation in Notch itself. This mutant is in the ADAM10 cleavage site and blocks proteolysis. Draw the expected outcome for such a mutant: GFP localization and developmental outcome 24hr after differentiation. WT before differentiation WT 24 hours after differentiationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Phylogeny and the Tree of Life; Author: Professor Dave Explains;https://www.youtube.com/watch?v=KLMn4XwS8Tw;License: Standard YouTube License, CC-BY