
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
3rd Edition
ISBN: 9781260670929
Author: Hoefnagels
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 20.1, Problem 2MC
Summary Introduction
To determine:
The relationships among the three levels of biodiversity and the importance of each level.
Introduction:
Biodiversity is defined as the variability among living organisms in terrestrial, marine, and other aquatic ecosystems. It describes the variety and richness of life on earth. Biodiversity plays an important role in the existence of humans and other species.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 20 Solutions
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
Ch. 20.1 - Prob. 1MCCh. 20.1 - Prob. 2MCCh. 20.1 - Prob. 3MCCh. 20.1 - Prob. 4MCCh. 20.2 - Prob. 1MCCh. 20.2 - Prob. 2MCCh. 20.2 - Prob. 3MCCh. 20.3 - How do toxic chemicals, nutrients, sediments, and...Ch. 20.3 - Prob. 2MCCh. 20.3 - Prob. 3MC
Ch. 20.4 - Why is CO2 accumulating in Earths atmosphere?Ch. 20.4 - Prob. 2MCCh. 20.4 - Prob. 3MCCh. 20.5 - Prob. 1MCCh. 20.5 - Prob. 2MCCh. 20.5 - Prob. 3MCCh. 20.6 - Prob. 1MCCh. 20.6 - Prob. 2MCCh. 20.6 - Prob. 3MCCh. 20 - Prob. 1MCQCh. 20 - What activity is the main cause of expanding...Ch. 20 - What is the connection between agriculture in the...Ch. 20 - What is the greenhouse effect? a. The filtering of...Ch. 20 - Prob. 5MCQCh. 20 - Prob. 6MCQCh. 20 - Prob. 7MCQCh. 20 - Prob. 8MCQCh. 20 - Prob. 1WIOCh. 20 - Prob. 2WIOCh. 20 - Prob. 3WIOCh. 20 - Prob. 4WIOCh. 20 - Prob. 5WIOCh. 20 - Prob. 6WIOCh. 20 - Prob. 7WIOCh. 20 - Prob. 8WIOCh. 20 - Prob. 9WIOCh. 20 - Prob. 10WIOCh. 20 - Prob. 11WIOCh. 20 - Prob. 12WIOCh. 20 - Prob. 13WIOCh. 20 - Prob. 14WIOCh. 20 - Prob. 15WIOCh. 20 - Prob. 16WIOCh. 20 - Prob. 17WIOCh. 20 - Prob. 18WIOCh. 20 - Prob. 1SLCh. 20 - Prob. 2SLCh. 20 - Review the Survey the Landscape figure in the...Ch. 20 - Prob. 2PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
