
Concept explainers
Are viruses generally considered living or nonliving? Explain

To determine: Whether viruses are considered as living or nonliving organisms.
Introduction: Viruses are small, microscopic organisms that are pathogenic to both prokaryotes (bacteria) and eukaryotes (animals, plants, and humans). They have a diameter ranging from 20nm to 300nm and also exhibit various shapes and structures. Viruses are intracellular parasites that are made of genetic material DNA or RNA. The genetic material is surrounded by a protein coat known as a capsid. A parasite is an organism that lives in a host, gets all the benefits from the host, and causes harm to it.
Explanation of Solution
A living being is made up of cells that exhibit characteristics like growth, movement, and reproduction. A nonliving thing does not show any such characteristics.
Viruses are considered as nonliving for the following reasons:
- Viruses are parasites that do not have cells or organelles but depend on host organelles for its processes.
- They cannot grow or develop on their own.
- They can only reproduce inside a host living cell.
- They do not respond to any external stimuli.
- Viruses neither have their own metabolism nor produce energy.
- Viruses are not killed by antibiotics, unlike bacteria.
Want to see more full solutions like this?
Chapter 19 Solutions
Campbell Biology (11th Edition)
Additional Science Textbook Solutions
Biological Science (6th Edition)
Campbell Essential Biology (7th Edition)
HUMAN ANATOMY
Biology: Life on Earth with Physiology (11th Edition)
SEELEY'S ANATOMY+PHYSIOLOGY
Laboratory Manual For Human Anatomy & Physiology
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning



