EBK HUMAN BIOLOGY
11th Edition
ISBN: 9780100545939
Author: MCMILLAN
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 18, Problem 2RQ
Summary Introduction
To explain: A chromosome.
Introduction: Nucleus is the largest organelle of the cell. It contains chromosomes that are a thread-like structure and carry genetic information in the form of the gene.
Summary Introduction
To distinguish: A haploid cell and a diploid cell.
Introduction: A chromosome is a thread-like structure made up of deoxyribonucleic acid (DNA). It is tightly packed in the nucleus of a cell. Humans normally have 23 pairs of chromosomes.
Expert Solution & Answer

Trending nowThis is a popular solution!

Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 18 Solutions
EBK HUMAN BIOLOGY
Ch. 18 - Prob. 1RQCh. 18 - Prob. 2RQCh. 18 - Prob. 3RQCh. 18 - Name the four main stages of mitosis, and describe...Ch. 18 - Prob. 5RQCh. 18 - Prob. 6RQCh. 18 - Prob. 1SQCh. 18 - Prob. 2SQCh. 18 - Prob. 3SQCh. 18 - Prob. 4SQ
Ch. 18 - Prob. 5SQCh. 18 - After mitosis, each daughter cell contains genetic...Ch. 18 - All of the following are stages of mitosis except...Ch. 18 - Prob. 8SQCh. 18 - Prob. 9SQCh. 18 - Because of the ________ alignment of homologous...Ch. 18 - Match the stage of mitosis with the following key...Ch. 18 - Normally you cant inherit both copies of a...Ch. 18 - Suppose you have a way of measuring the amount of...Ch. 18 - Adams maternal and paternal chromosomes have...Ch. 18 - Fresh out of college, Maria has her first job...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
General Embryology Review in 20 minutes; Author: Medical Animations;https://www.youtube.com/watch?v=4YKvVeVMmEE;License: Standard youtube license