Prescott's Microbiology
11th Edition
ISBN: 9781260211887
Author: WILLEY, Sandman, Wood
Publisher: McGraw Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17.1, Problem 7MI
In what ways does the BAC shown here differ from the plasmid pUC19 shown in figure 17.10?
Bacterial artificial chromosome (BAC)
Figure 17.10
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
pXO1 and pXO2 are large plasmids – large pieces of DNA that are not the chromosome that can replicate independently of the chromosome. What can a Bacillus anthracis cell with a pXO2 plasmid do that a cell without pXO2 can’t?
I need help answering this quwhstion as short as possible based of what is said in the paper
For each item, indicate if it is demonstrating vertical gene transfer or horizontal gene transfer:
E. coli cell undergoes binary fission to produce two daughter cells
Yeast cell buds [Select]
Select]
A plasmid is transferred from one bacterium to another [Select]
A phage shuttles DNA captured from one host cell into another cell, where it is incorporated into the
chromosomal DNA through homologous recombination [Select]
A Streptococcus cell takes up small fragments of DNA released from other dving Streptococci in the
environment and incorporates them into its chromosom
✓ [Select]
Horizontal
Vertical
On Figure 1, what is occurring at the positions C indicated by black arrows?
Chapter 17 Solutions
Prescott's Microbiology
Ch. 17.1 - Examine the uncut piece of DNA shown in the upper...Ch. 17.1 - Which of the above enzymes yield blunt ends? Which...Ch. 17.1 - Prob. 3MICh. 17.1 - What would you conclude if you obtained only blue...Ch. 17.1 - Why must introns be removed from eukaryotic DNA...Ch. 17.1 - Which plasmid is a shuttle vector? Why?Ch. 17.1 - In what ways does the BAC shown here differ from...Ch. 17.1 - Describe restriction enzymes, sticky ends, and...Ch. 17.1 - What is cDNA? Why is it necessary to generate cDNA...Ch. 17.1 - Prob. 3CC
Ch. 17.1 - Prob. 4CCCh. 17.1 - Prob. 5CCCh. 17.2 - Why, after three cycles, are the vast majority of...Ch. 17.2 - Briefly describe the polymerase chain reaction....Ch. 17.2 - Why is PCR used to detect infectious agents that...Ch. 17.2 - How would you use PCR to measure the concentration...Ch. 17.2 - Why is it possible to visualize a PCR product on...Ch. 17.2 - Prob. 5CCCh. 17.3 - Why are long fragments (e.g., 20,000 bp) of...Ch. 17.4 - What special considerations are necessary if one...Ch. 17.4 - Prob. 1CCCh. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - You are studying chemotaxis proteins in a newly...Ch. 17.5 - Prob. 1MICh. 17.5 - Prob. 1CCCh. 17.5 - Prob. 2CCCh. 17 - Which of the DNA molecules shown are recombinant?Ch. 17 - Prob. 1RCCh. 17 - Prob. 2RCCh. 17 - Prob. 3RCCh. 17 - Prob. 4RCCh. 17 - Prob. 5RCCh. 17 - Prob. 6RCCh. 17 - Prob. 1ALCh. 17 - Prob. 2ALCh. 17 - Suppose you transformed a plasmid vector carrying...Ch. 17 - You are interested in the activity and regulation...Ch. 17 - Prob. 5ALCh. 17 - Prob. 6ALCh. 17 - Prob. 7AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the Hershey Chase experiment, why was the localization of radio-labeled phage of macromolecules in the cytoplasm the reason that the genetic material identity was proved.arrow_forwardOn Figure 1, what is the name of the main actor located at positions C?arrow_forwardBacterial conjugation has medical consequences. For example, certain plasmids contain genes that code for toxins. The causative agent of a deadly form of food poisoning, E. coli 0157, synthesizes a toxin that causes massive bloody diarrhea and kidney failure. This toxin is now believed to have originated in Shigella, another bacterium that causes dysentery. Similarly, the growing problem of antibiotic resistance is partly attributable to the spread of antibioticresistant genes among bacterial populations. Antibiotic resistance develops because antibiotics are overused in medical practice and in livestock feeds. Suggest a mechanism by which this extensive use promotes antibiotic resistance.arrow_forward
- The gene atg-12 codes for a protein associated with abnormal rates of cell destruction and recycling of cell contents. Scientists studying bacterial plasmids devised an experiment using recombinant DNA techniques to remove a section of DNA (gene atg-12) of a bacterial plasmid (pOKE103) and create a new plasmid (pOKE104) that did not contain the gene atg-12. The new plasmid was then incorporated within the DNA of the fungus Neurospora crassa in cellular studies. Which statement explains the expected heredity of fungi that incorporate pOKE104? A - Fungi that incorporate pOKE104 will produce the protein from gene atg-12 and have increased rates of malignant tumors. B - Fungi that incorporate pOKE104 will not produce the protein from gene atg-12 but will have a normal appearance. C - The prokaryotic DNA will remain separate within the fungal cells, produce the protein from gene atg-12, and have increased rates of malignant tumors. D - The prokaryotic DNA will remain separate within the…arrow_forwardThe genes for both the α- and βglobin chains of hemoglobin contain introns (i.e., they are split genes). How would this fact affect your plans if you wanted to introduce the gene for α-globin into a bacterial plasmid and have the bacteria produce α-globin?arrow_forwardIn Figure 10-14, why does DNA migrate to the anode(+ pole)?arrow_forward
- You are interested in synthesizing a variant of Synechocystis sp. pcc 7803 ferredoxin having mutation (E) at its 38th residue. The gene is encoded in a pET21b vector (5.3 kbp). If you use 0.10 ng of the template plasmid (pET21b SynFd), calculate the ratio of the original to the mutated gene after 10 versus 20 cycles.arrow_forwardIf the recipient cell did not already have a lys− gene, could the lys+ DNA become incorporated into the bacterial chromosome? Explain.arrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forward
- Hi, this is my Recombinant "Paper" Plasmid activity question, I did other parts, but this question I really have no clue what it is. I attached a photo of the letters on the inserted gene code, please help me figure out what it means, Thanks a lot. It is the shaded regionarrow_forwardBelow is a diagram of the general structure of the bacteriophagel chromosome. Speculate on the mechanism by which it forms aclosed ring upon infection of the host cell. 5'GGGCGGCGACCT:double@stranded region-3' 3'- double@stranded region:CCCGCCGCTGGA5'arrow_forwardIn Hershey-Chase experiment, bacteriophages protein coats were tagged with radioactive isotope S-32. These phages were used to infect E. coli cells and the cells were further centrifuged to form pellets. Why was the radioactivity level of S-32 found greater outside the cells compared to the E. coli cell pellets? Explain briefly. If the experiment is repeated in the same manner but this time the phage protein coats are labelled with isotope X and the phage DNA with isotope Y, which isotope’s radioactivity will be found in greater amounts in the E. coli cell pellets after centrifugation? Explain briefly.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license