Prescott's Microbiology
11th Edition
ISBN: 9781260211887
Author: WILLEY, Sandman, Wood
Publisher: McGraw Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17.1, Problem 1MI
Examine the uncut piece of DNA shown in the upper half of this figure. Where would an exonuclease cleave?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Name the enzymes that cut the DNA at specific sequences and create sticky ends.
A DNA strand was sequenced using the Sanger method
(https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction
tube contained the DNA strand, fluorescently labelled
dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green,
ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA
polymerase, or its Klenow fragment. Synthesis of DNA is allowed to
proceed, and the results are shown on the right:
15
14
13
12
11
10
(a) What is the sequence of the copy and the template strands?
(b) If the template strand were in the 5'-3' direction, what will be
the sequence of the DNA copy?
Nucleotide Length
please do only part D .
Chapter 17 Solutions
Prescott's Microbiology
Ch. 17.1 - Examine the uncut piece of DNA shown in the upper...Ch. 17.1 - Which of the above enzymes yield blunt ends? Which...Ch. 17.1 - Prob. 3MICh. 17.1 - What would you conclude if you obtained only blue...Ch. 17.1 - Why must introns be removed from eukaryotic DNA...Ch. 17.1 - Which plasmid is a shuttle vector? Why?Ch. 17.1 - In what ways does the BAC shown here differ from...Ch. 17.1 - Describe restriction enzymes, sticky ends, and...Ch. 17.1 - What is cDNA? Why is it necessary to generate cDNA...Ch. 17.1 - Prob. 3CC
Ch. 17.1 - Prob. 4CCCh. 17.1 - Prob. 5CCCh. 17.2 - Why, after three cycles, are the vast majority of...Ch. 17.2 - Briefly describe the polymerase chain reaction....Ch. 17.2 - Why is PCR used to detect infectious agents that...Ch. 17.2 - How would you use PCR to measure the concentration...Ch. 17.2 - Why is it possible to visualize a PCR product on...Ch. 17.2 - Prob. 5CCCh. 17.3 - Why are long fragments (e.g., 20,000 bp) of...Ch. 17.4 - What special considerations are necessary if one...Ch. 17.4 - Prob. 1CCCh. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - You are studying chemotaxis proteins in a newly...Ch. 17.5 - Prob. 1MICh. 17.5 - Prob. 1CCCh. 17.5 - Prob. 2CCCh. 17 - Which of the DNA molecules shown are recombinant?Ch. 17 - Prob. 1RCCh. 17 - Prob. 2RCCh. 17 - Prob. 3RCCh. 17 - Prob. 4RCCh. 17 - Prob. 5RCCh. 17 - Prob. 6RCCh. 17 - Prob. 1ALCh. 17 - Prob. 2ALCh. 17 - Suppose you transformed a plasmid vector carrying...Ch. 17 - You are interested in the activity and regulation...Ch. 17 - Prob. 5ALCh. 17 - Prob. 6ALCh. 17 - Prob. 7AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Write the base sequence of the DNA template from whichthis RNA sequence was derived: GUAUCAAUGAACUUG.How many amino acids are coded for in this sequence?arrow_forwardA). Briefly describe the function of telomerase. B). How does the structure of telomerase allow it to complete the function you described?arrow_forwardUse the first picture for to answer the following questions.arrow_forward
- If the sequence 5′-AACGC-3′ were damaged by reactive oxygen species, what would be the most prevalent product, and what would be the result of replication? (Note: show both strands after replication)arrow_forwardDescribe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in the target DNA sequence, which is present in only one copy in the starting sample, and (b) there is a doublestranded break in the target DNA sequence, which is present in only one copy in the starting sample.arrow_forwardWhat is a processive enzyme? Explain why processivity is an important feature of DNA polymerase.arrow_forward
- Telomerase adds six deoxynucleotides to the end of a DNA strand using a built-in RNA template. Explain why the templating region of the RNA includes one and a half repeats of the telomeric sequence (∼9 nucleotides).arrow_forwardExamine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be able to amplify this entire DNA fragment. Your answer must fulfill the following criteria: Design the primers so that they are each 7 bases in length. Please write out the sequence of these primers. Don’t forget to indicate the direction (polarity) of both ends of each primer. Note that only the polarity of one end of one of the template strands of DNA is provided below. Describe where the primer would bind (i.e. top or bottom template strand, left or right side of the DNA strand) Organize your response so that each primer, and associated information, is separated by at least one blank linearrow_forwardExamine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TGCTATC 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. This primer cannot be used in the PCR process. b. It will bind to the top strand on the left side of the fragment. c. It will bind to the bottom strand on the left side of the fragment. d. It will bind to the bottom strand on the right side of the fragment. e. It will bind to the top strand on the right side of the fragment.arrow_forward
- Why do adult human cells (other than germ cells and stem cells) NOT express the enzyme telomerase? In other words what benefit does not having telomerase provide to these cells?arrow_forwardExamine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TTGCATCG 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA, and will this primer work as part of a pair to successfully amplify this fragment of DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. It will bind to the bottom strand on the left side of the fragment, and is suitable to amplify the fragment by PCR. b. It will bind to the top strand on the left side of the fragment, but it is unsuitable to amplify the fragment by PCR. c. It will bind to the top strand on the right side of the fragment, but it is unsuitable to amplify the fragment by PCR. d. It will bind to the bottom strand on the right side of the…arrow_forwardA small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis.The following data were obtained. (a) Is the original molecule linear or circular?(b) Draw a map of restriction sites (showing distances between sites) that isconsistent with the data given.(c) How many additional maps are compatible with the data?(d) What would have to be done to locate the cleavage sites unambiguouslywith respect to each other?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY