
The meaning of sensory receptor and the range of structures encompassed by the term

To determine:
The meaning of the term sensory receptor and the different structures encompassed by this term
Introduction:
There are several types of receptors, such as chemoreceptors, mechanoreceptors, and photoreceptors. The receptors that produce responses against the chemical stimulus are termed as chemoreceptors. The receptors that produce responses against light-related stimuli are termed as photoreceptors.
Explanation of Solution
A sensory receptor refers to the structure that is specialized in detecting a particular stimulus. The receptors may include simple nerve endings called the dendrites. The receptors may also include the nerve ending that combines with connective, muscular, or epithelial tissues, and such receptors are known as sense organs. The sense organs play an important role in enhancing the response to a particular stimulus.
The receptors that can be classified on the basis of the modality are thermoreceptors, photoreceptors, chemoreceptors, nociceptors, and mechanoreceptors. The receptors can also be classified on the basis of the distribution of receptors, and these are general senses and special senses. The types of receptors based on the origins of stimuli are exteroceptors, interoceptors, and proprioceptors.
Thus, sensory receptors can be defined as the structure specialized to recognize a specific stimulus. The receptors may include dendrites or sense organs. The types of receptors are photoreceptors, chemoreceptors, nociceptors, thermoreceptors, and mechanoreceptors based on the modality.
Want to see more full solutions like this?
Chapter 17 Solutions
HUMAN ANATOMY
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
