Even though the lac Z , Y, and A structural genes are transcribed as a single polycistronic mRNA, each gene contains the initiation and termination signals essential for translation. Predict what will happen when a cell growing in the presence of lactose contains a deletion of one nucleotide (a) early in the Z gene and (b) early in the A gene.

Question

Want to see more full solutions like this?

Answer 1

Textbook Question

Chapter 16, Problem 1NST

Even though the lac Z, Y, and A structural genes are transcribed as a single polycistronic mRNA, each gene contains the initiation and termination signals essential for translation. Predict what will happen when a cell growing in the presence of lactose contains a deletion of one nucleotide (a) early in the Z gene and (b) early in the A gene.

(a)

Expert Solution

Summary Introduction

To determine: The fate of a cell growing in the presence of lactose and containing a deletion in one of the nucleotides presents early in the Z gene.

Introduction: The lac operon contains its promoter, regulator, and three structural genes designated as Z, Y, and A. The Z gene encodes β-galactosidase aids in cleaving the disaccharide lactose into its monomers glucose and galactose.

Explanation of Solution

If there is a deletion of one nucleotide in the early Z gene, then there will be a frameshift of all the reading frames present downstream from the deletion, which alters many amino acids. As a result of mutation, either premature chain termination of the translation will occur, or the normal chain termination will be ignored. If such a cell is placed in a lactose medium, it will be incapable of growing because of the unavailability of the β-galactosidase gene.

Thus, the cell with a deletion mutation in the early Z gene is incapable of growing in lactose medium because of the absence of the β-galactosidase gene.

(b)

Expert Solution

Summary Introduction

To determine: The fate of a cell growing in the presence of lactose and containing a deletion in one of the nucleotides present early in the A gene

Introduction: The lac operon contains three structural genes known as lacZ, lacY, and lacA. The three genes are transcribed in the form of a single mRNA under the control of one lac promoter. The lacA codes for transacetylase that transfer acetyl groups from acetyl-coenzyme A to β-galactoside.

Explanation of Solution

When there is a deletion of one nucleotide in the early A gene, the expected function of A gene product is impaired, but the use of lactose as a carbon source is not influenced. In this situation, if a cell is placed in a lactose-containing medium, then the cell will grow normally.

Thus, the cell with a deletion mutation in the early A gene has impaired gene A product, and it can grow normally in the lactose-containing medium.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Even though the LacZ,Y and A structural genes are transcribed as a single polycistronic mRNA, each gene contains the initiation and termination signals essential for translation. Predict what will happen when a cell growing in the presence of lactose contains a deletion of one nucleotide early in the Z gene and early in the A gene.

Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?

The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?

Answer 2

Textbook Question

Chapter 16, Problem 1NST

Even though the lac Z, Y, and A structural genes are transcribed as a single polycistronic mRNA, each gene contains the initiation and termination signals essential for translation. Predict what will happen when a cell growing in the presence of lactose contains a deletion of one nucleotide (a) early in the Z gene and (b) early in the A gene.

(a)

Expert Solution

Summary Introduction

To determine: The fate of a cell growing in the presence of lactose and containing a deletion in one of the nucleotides presents early in the Z gene.

Introduction: The lac operon contains its promoter, regulator, and three structural genes designated as Z, Y, and A. The Z gene encodes β-galactosidase aids in cleaving the disaccharide lactose into its monomers glucose and galactose.

Explanation of Solution

If there is a deletion of one nucleotide in the early Z gene, then there will be a frameshift of all the reading frames present downstream from the deletion, which alters many amino acids. As a result of mutation, either premature chain termination of the translation will occur, or the normal chain termination will be ignored. If such a cell is placed in a lactose medium, it will be incapable of growing because of the unavailability of the β-galactosidase gene.

Thus, the cell with a deletion mutation in the early Z gene is incapable of growing in lactose medium because of the absence of the β-galactosidase gene.

(b)

Expert Solution

Summary Introduction

To determine: The fate of a cell growing in the presence of lactose and containing a deletion in one of the nucleotides present early in the A gene

Introduction: The lac operon contains three structural genes known as lacZ, lacY, and lacA. The three genes are transcribed in the form of a single mRNA under the control of one lac promoter. The lacA codes for transacetylase that transfer acetyl groups from acetyl-coenzyme A to β-galactoside.

Explanation of Solution

When there is a deletion of one nucleotide in the early A gene, the expected function of A gene product is impaired, but the use of lactose as a carbon source is not influenced. In this situation, if a cell is placed in a lactose-containing medium, then the cell will grow normally.

Thus, the cell with a deletion mutation in the early A gene has impaired gene A product, and it can grow normally in the lactose-containing medium.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Textbook Question

Chapter 16, Problem 1NST

Even though the lac Z, Y, and A structural genes are transcribed as a single polycistronic mRNA, each gene contains the initiation and termination signals essential for translation. Predict what will happen when a cell growing in the presence of lactose contains a deletion of one nucleotide (a) early in the Z gene and (b) early in the A gene.

(a)

Expert Solution

Summary Introduction

To determine: The fate of a cell growing in the presence of lactose and containing a deletion in one of the nucleotides presents early in the Z gene.

Introduction: The lac operon contains its promoter, regulator, and three structural genes designated as Z, Y, and A. The Z gene encodes β-galactosidase aids in cleaving the disaccharide lactose into its monomers glucose and galactose.

Explanation of Solution

If there is a deletion of one nucleotide in the early Z gene, then there will be a frameshift of all the reading frames present downstream from the deletion, which alters many amino acids. As a result of mutation, either premature chain termination of the translation will occur, or the normal chain termination will be ignored. If such a cell is placed in a lactose medium, it will be incapable of growing because of the unavailability of the β-galactosidase gene.

Thus, the cell with a deletion mutation in the early Z gene is incapable of growing in lactose medium because of the absence of the β-galactosidase gene.

(b)

Expert Solution

Summary Introduction

To determine: The fate of a cell growing in the presence of lactose and containing a deletion in one of the nucleotides present early in the A gene

Introduction: The lac operon contains three structural genes known as lacZ, lacY, and lacA. The three genes are transcribed in the form of a single mRNA under the control of one lac promoter. The lacA codes for transacetylase that transfer acetyl groups from acetyl-coenzyme A to β-galactoside.

Explanation of Solution

When there is a deletion of one nucleotide in the early A gene, the expected function of A gene product is impaired, but the use of lactose as a carbon source is not influenced. In this situation, if a cell is placed in a lactose-containing medium, then the cell will grow normally.

Thus, the cell with a deletion mutation in the early A gene has impaired gene A product, and it can grow normally in the lactose-containing medium.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Textbook Question

Chapter 16, Problem 1NST

Even though the lac Z, Y, and A structural genes are transcribed as a single polycistronic mRNA, each gene contains the initiation and termination signals essential for translation. Predict what will happen when a cell growing in the presence of lactose contains a deletion of one nucleotide (a) early in the Z gene and (b) early in the A gene.

(a)

Expert Solution

Summary Introduction

To determine: The fate of a cell growing in the presence of lactose and containing a deletion in one of the nucleotides presents early in the Z gene.

Introduction: The lac operon contains its promoter, regulator, and three structural genes designated as Z, Y, and A. The Z gene encodes β-galactosidase aids in cleaving the disaccharide lactose into its monomers glucose and galactose.

Explanation of Solution

If there is a deletion of one nucleotide in the early Z gene, then there will be a frameshift of all the reading frames present downstream from the deletion, which alters many amino acids. As a result of mutation, either premature chain termination of the translation will occur, or the normal chain termination will be ignored. If such a cell is placed in a lactose medium, it will be incapable of growing because of the unavailability of the β-galactosidase gene.

Thus, the cell with a deletion mutation in the early Z gene is incapable of growing in lactose medium because of the absence of the β-galactosidase gene.

(b)

Expert Solution

Summary Introduction

To determine: The fate of a cell growing in the presence of lactose and containing a deletion in one of the nucleotides present early in the A gene

Introduction: The lac operon contains three structural genes known as lacZ, lacY, and lacA. The three genes are transcribed in the form of a single mRNA under the control of one lac promoter. The lacA codes for transacetylase that transfer acetyl groups from acetyl-coenzyme A to β-galactoside.

Explanation of Solution

When there is a deletion of one nucleotide in the early A gene, the expected function of A gene product is impaired, but the use of lactose as a carbon source is not influenced. In this situation, if a cell is placed in a lactose-containing medium, then the cell will grow normally.

Thus, the cell with a deletion mutation in the early A gene has impaired gene A product, and it can grow normally in the lactose-containing medium.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Textbook Question

Answer 6

Textbook Question

Answer 7

(a)

Expert Solution

Summary Introduction

To determine: The fate of a cell growing in the presence of lactose and containing a deletion in one of the nucleotides presents early in the Z gene.

Introduction: The lac operon contains its promoter, regulator, and three structural genes designated as Z, Y, and A. The Z gene encodes β-galactosidase aids in cleaving the disaccharide lactose into its monomers glucose and galactose.

Explanation of Solution

If there is a deletion of one nucleotide in the early Z gene, then there will be a frameshift of all the reading frames present downstream from the deletion, which alters many amino acids. As a result of mutation, either premature chain termination of the translation will occur, or the normal chain termination will be ignored. If such a cell is placed in a lactose medium, it will be incapable of growing because of the unavailability of the β-galactosidase gene.

Thus, the cell with a deletion mutation in the early Z gene is incapable of growing in lactose medium because of the absence of the β-galactosidase gene.

(b)

Expert Solution

Summary Introduction

To determine: The fate of a cell growing in the presence of lactose and containing a deletion in one of the nucleotides present early in the A gene

Introduction: The lac operon contains three structural genes known as lacZ, lacY, and lacA. The three genes are transcribed in the form of a single mRNA under the control of one lac promoter. The lacA codes for transacetylase that transfer acetyl groups from acetyl-coenzyme A to β-galactoside.

Explanation of Solution

When there is a deletion of one nucleotide in the early A gene, the expected function of A gene product is impaired, but the use of lactose as a carbon source is not influenced. In this situation, if a cell is placed in a lactose-containing medium, then the cell will grow normally.

Thus, the cell with a deletion mutation in the early A gene has impaired gene A product, and it can grow normally in the lactose-containing medium.

Answer 8

(a)

Expert Solution

Summary Introduction

To determine: The fate of a cell growing in the presence of lactose and containing a deletion in one of the nucleotides presents early in the Z gene.

Introduction: The lac operon contains its promoter, regulator, and three structural genes designated as Z, Y, and A. The Z gene encodes β-galactosidase aids in cleaving the disaccharide lactose into its monomers glucose and galactose.

Explanation of Solution

If there is a deletion of one nucleotide in the early Z gene, then there will be a frameshift of all the reading frames present downstream from the deletion, which alters many amino acids. As a result of mutation, either premature chain termination of the translation will occur, or the normal chain termination will be ignored. If such a cell is placed in a lactose medium, it will be incapable of growing because of the unavailability of the β-galactosidase gene.

Thus, the cell with a deletion mutation in the early Z gene is incapable of growing in lactose medium because of the absence of the β-galactosidase gene.

Answer 9

(a)

Expert Solution

Answer 10

(a)

Expert Solution

Answer 11

Expert Solution

Answer 12

Summary Introduction

To determine: The fate of a cell growing in the presence of lactose and containing a deletion in one of the nucleotides presents early in the Z gene.

Introduction: The lac operon contains its promoter, regulator, and three structural genes designated as Z, Y, and A. The Z gene encodes β-galactosidase aids in cleaving the disaccharide lactose into its monomers glucose and galactose.

Answer 13

Explanation of Solution

If there is a deletion of one nucleotide in the early Z gene, then there will be a frameshift of all the reading frames present downstream from the deletion, which alters many amino acids. As a result of mutation, either premature chain termination of the translation will occur, or the normal chain termination will be ignored. If such a cell is placed in a lactose medium, it will be incapable of growing because of the unavailability of the β-galactosidase gene.

Thus, the cell with a deletion mutation in the early Z gene is incapable of growing in lactose medium because of the absence of the β-galactosidase gene.

Answer 14

(b)

Expert Solution

Summary Introduction

To determine: The fate of a cell growing in the presence of lactose and containing a deletion in one of the nucleotides present early in the A gene

Introduction: The lac operon contains three structural genes known as lacZ, lacY, and lacA. The three genes are transcribed in the form of a single mRNA under the control of one lac promoter. The lacA codes for transacetylase that transfer acetyl groups from acetyl-coenzyme A to β-galactoside.

Explanation of Solution

When there is a deletion of one nucleotide in the early A gene, the expected function of A gene product is impaired, but the use of lactose as a carbon source is not influenced. In this situation, if a cell is placed in a lactose-containing medium, then the cell will grow normally.

Thus, the cell with a deletion mutation in the early A gene has impaired gene A product, and it can grow normally in the lactose-containing medium.

Answer 15

(b)

Expert Solution

Answer 16

(b)

Expert Solution

Answer 17

Expert Solution

Answer 18

Summary Introduction

To determine: The fate of a cell growing in the presence of lactose and containing a deletion in one of the nucleotides present early in the A gene

Introduction: The lac operon contains three structural genes known as lacZ, lacY, and lacA. The three genes are transcribed in the form of a single mRNA under the control of one lac promoter. The lacA codes for transacetylase that transfer acetyl groups from acetyl-coenzyme A to β-galactoside.

Answer 19

Explanation of Solution

When there is a deletion of one nucleotide in the early A gene, the expected function of A gene product is impaired, but the use of lactose as a carbon source is not influenced. In this situation, if a cell is placed in a lactose-containing medium, then the cell will grow normally.

Thus, the cell with a deletion mutation in the early A gene has impaired gene A product, and it can grow normally in the lactose-containing medium.

Answer 20

Ch. 16 - Even though the lac Z, Y, and A structural genes...Ch. 16 - Predict the level of genetic activity of the lac...Ch. 16 - Prob. 1CS Ch. 16 - Prob. 2CS Ch. 16 - Prob. 3CS Ch. 16 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 16 - Prob. 2PDQ Ch. 16 - Contrast positive versus negative control of gene...Ch. 16 - Contrast the role of the repressor in an inducible...Ch. 16 - For the lac genotypes shown in the following...

Concept explainers

Videos

Explanation of Solution

Explanation of Solution

Want to see more full solutions like this?

Chapter 16 Solutions