
Concept explainers
How is sensation different from perception?

To review:
The difference between sensation and perception.
Introduction:
Sensation is the ability to feel something physically. It can be defined as the process through which the senses collect information and then send them to the brain for its further interpretation. The perception, on the other hand, is the faculty or art of apprehension by the means of different senses or mind. It involves cognition understanding.
Explanation of Solution
The difference between sensation and perception is as follows:
S. no | Sensation | Perception |
1. | It is a passive process that collect information from outside world. | It is an active process that involves selection, organization, and interpretation. |
2. | It depends on the surroundings. | It is shaped by learning, expectation, and memory. |
3. | It gathers the changes in the external or internal environment consciously or subconsciously. | It is a conscious interpretation of the sensation. |
4. | Most sensory information never reaches cerebral cortex. | It is a primary function of the cerebral cortex. |
Thus, the sensations have a physical source while the perception is totally cognitive based.
Want to see more full solutions like this?
Chapter 16 Solutions
Principles of Anatomy and Physiology
Additional Science Textbook Solutions
Biological Science (6th Edition)
Genetics: From Genes to Genomes
Campbell Essential Biology (7th Edition)
HUMAN ANATOMY
Organic Chemistry
Biology: Life on Earth with Physiology (11th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning


