
Biological Science
5th Edition
ISBN: 9780321743671
Author: Scott Freeman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 16, Problem 13TYPSS
Recall that DNA and RNA are synthesized only in the 5'→3' direction and that DNA and RNA sequences are written in the 5'→3' direction, unless otherwise noted. Consider the following DNA sequence:
5' TTGAAATGCCCGTTTGGAGATCGGGTTACAGCTAGTCAAAG 3'
3' AACTTTACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'
• Identify bases in the bottom strand that can be transcribed into start and stop codons.
• Write the mRNA sequence that would be transcribed between start and stop codons if the bottom strand served as the template for RNA polymerase.
• Write the amino acid sequence that would be translated from the mRNA sequence you just wrote.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
engineered constructs that consist of hollow fibers are acting as synthetic capillaries, around which cells have been loaded. The cellular space around a single fiber can be modeled as if it were a Krogh tissue cylinder. Each fiber has an outside “capillary” radius of 100 µm and the “tissue” radius can be taken as 200 µm. The following values apply to the device:R0 = 20 µM/secaO2 = 1.35 µM/mmHgDO2,T = 1.67 x 10-5 cm2/secPO2,m = 4 x 10-3 cm/secInstead of blood inside the fibers, the oxygen transport and tissue consumption are being investigated by usingan aqueous solution saturated with pure oxygen. As a result, there is no mass transfer resistance in the synthetic“capillary”, only that due to the membrane itself. Rather than accounting for pO2 variations along the length ofthe fiber, use an average value in the “capillary” of 130 mmHg.Is the tissue fully oxygenated?
Molecular Biology
Please help with question. thank you
You are studying the expression of the lac operon. You have isolated mutants as described below. In the presence of glucose, explain/describe what would happen, for each mutant, to the expression of the lac operon when you add lactose AND what would happen when the bacteria has used up all of the lactose (if the mutant is able to use lactose).5. Mutations in the lac operator that strengthen the binding of the lac repressor 200 fold
6. Mutations in the promoter that prevent binding of RNA polymerase
7. Mutations in CRP/CAP protein that prevent binding of cAMP8. Mutations in sigma factor that prevent binding of sigma to core RNA polymerase
Molecular Biology
Please help and there is an attached image. Thank you.
A bacteria has a gene whose protein/enzyme product is involved with the synthesis of a lipid necessary for the synthesis of the cell membrane. Expression of this gene requires the binding of a protein (called ACT) to a control sequence (called INC) next to the promoter.
A. Is the expression/regulation of this gene an example of induction or repression?Please explain:B. Is this expression/regulation an example of positive or negative control?C. When the lipid is supplied in the media, the expression of the enzyme is turned off.Describe one likely mechanism for how this “turn off” is accomplished.
Chapter 16 Solutions
Biological Science
Ch. 16 -
1. What does the one-gene, one-enzyme hypothesis...Ch. 16 - 2. Which of the following is an important...Ch. 16 - Prob. 3TYKCh. 16 - Prob. 5TYKCh. 16 - Prob. 4TYKCh. 16 - Prob. 6TYKCh. 16 -
7. Explain why Morse code is an appropriate...Ch. 16 - MODEL Draw a hypothetical metabolic pathway in...Ch. 16 - Prob. 9TYUCh. 16 - Prob. 16TYPSS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Molecular Biology Please help. Thank you. Discuss/define the following:(a) poly A polymerase (b) trans-splicing (c) operonarrow_forwardMolecular Biology Please help with question. Thank you in advance. Discuss, compare and contrast the structure of promoters inprokaryotes and eukaryotes.arrow_forwardMolecular Biology Please help with question. Thank you You are studying the expression of the lac operon. You have isolated mutants as described below. In the absence of glucose, explain/describe what would happen, for each mutant, to the expression of the lac operon when you add lactose AND what would happen when the bacteria has used up all of the lactose (if the mutant is able to use lactose).1. Mutations in the lac repressor gene that would prevent the binding of lactose2. Mutations in the lac repressor gene that would prevent release of lactose once lactose hadbound3. Normally the lac repressor gene is located next to (a few hundred base pairs) and upstreamfrom the lac operon. Mutations in the lac repressor gene that move the lac repressor gene 100,000base pairs downstream.4. Mutations in the lac operator that would prevent binding of lac repressorarrow_forward
- You have returned to college to become a phylogeneticist. One of the first things you wish to do is determine how mammals, birds, and reptiles are related. Like any good scientist, you need to consider all available data objectively and without a preconceived “correct” answer. In pursuit of that, you should produce a phylogenetic tree based only on morphological features that show birds and mammals are more closely related. You will then produce a totally different tree, also using morphological features, that shows birds and reptiles are more closely related. Do not forget to include all three groups in both your trees. Based solely off the trees you produce, which relationship would you consider the more likely and why? Once you have answered that question, provide a brief summary of the “modern” understanding of the relationship between these three groups.arrow_forwardtrue or false, the reason geckos can walk on walls is hydrogen bonding between their foot pads and the moisture on the wall.arrow_forwardBiology laboratory problem Please help. thank you You have 20 ul of DNA solution and 6X DNA loading buffer solution. You have to mix your DNA solution and DNA loading buffer before load DNA in an agarose gel. The concentration of the DNA loading buffer must be 1X in the DNA and DNA-loading buffer mixture after you mix them. For that, I will add _____ ul of 6X loading buffer to the 20 ul DNA solution.arrow_forward
- Biology lab problem To make 20 ul of 5 mM MgCl2 solution using 50 mM MgCl2 stock solution and distilled water, I will mix ________ ul of 50 mM MgCl2 solution and ________ ul of distilled water. Please help . Thank youarrow_forwardBiology Please help. Thank you. Biology laboratory question You need 50 ml of 1% (w/v) agarose gel. Agarose is a powder. How would you make it? You can ignore the volume of agarose powder. Don't forget the unit.TBE buffer is used to make an agarose gel, not distilled water. I will add _______ of agarose powder into 50 ml of distilled water (final 50 ml).arrow_forwardAn urgent care center experienced the average patient admissions shown in the Table below during the weeks from the first week of December through the second week of April. Week Average Daily Admissions 1-Dec 11 2-Dec 14 3-Dec 17 4-Dec 15 1-Jan 12 2-Jan 11 3-Jan 9 4-Jan 9 1-Feb 12 2-Feb 8 3-Feb 13 4-Feb 11 1-Mar 15 2-Mar 17 3-Mar 14 4-Mar 19 5-Mar 13 1-Apr 17 2-Apr 13 Forecast admissions for the periods from the first week of December through the second week of April. Compare the forecast admissions to the actual admissions; What do you conclude?arrow_forward
- Analyze the effectiveness of the a drug treatment program based on the needs of 18-65 year olds who are in need of treatment by critically describing 4 things in the program is doing effectively and 4 things the program needs some improvement.arrow_forwardI have the first half finished... just need the bottom half.arrow_forward13. Practice Calculations: 3 colonies were suspended in the following dilution series and then a viable plate count and microscope count was performed. Calculate IDF's, TDF's and then calculate the CFU/mL in each tube by both methods. Finally calculate the cells in 1 colony by both methods. Show all of your calculations in the space provided on the following pages. 3 colonies 56 cells 10 μL 10 μL 100 μL 500 με m OS A B D 5.0 mL 990 με 990 με 900 με 500 μL EN 2 100 με 100 μL 118 colonies 12 coloniesarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY