Biological Science
Biological Science
5th Edition
ISBN: 9780321743671
Author: Scott Freeman
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 16, Problem 13TYPSS

Recall that DNA and RNA are synthesized only in the 5'→3' direction and that DNA and RNA sequences are written in the 5'→3' direction, unless otherwise noted. Consider the following DNA sequence:

5' TTGAAATGCCCGTTTGGAGATCGGGTTACAGCTAGTCAAAG 3'

3' AACTTTACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

• Identify bases in the bottom strand that can be transcribed into start and stop codons.

• Write the mRNA sequence that would be transcribed between start and stop codons if the bottom strand served as the template for RNA polymerase.

• Write the amino acid sequence that would be translated from the mRNA sequence you just wrote.

Blurred answer
Students have asked these similar questions
engineered constructs that consist of hollow fibers are acting as synthetic capillaries, around which cells have been loaded. The cellular space around a single fiber can be modeled as if it were a Krogh tissue cylinder. Each fiber has an outside “capillary” radius of 100 µm and the “tissue” radius can be taken as 200 µm. The following values apply to the device:R0 = 20 µM/secaO2 = 1.35 µM/mmHgDO2,T = 1.67 x 10-5 cm2/secPO2,m = 4 x 10-3 cm/secInstead of blood inside the fibers, the oxygen transport and tissue consumption are being investigated by usingan aqueous solution saturated with pure oxygen. As a result, there is no mass transfer resistance in the synthetic“capillary”, only that due to the membrane itself. Rather than accounting for pO2 variations along the length ofthe fiber, use an average value in the “capillary” of 130 mmHg.Is the tissue fully oxygenated?
Molecular Biology Please help with question. thank you You are studying the expression of the lac operon. You have isolated mutants as described below. In the presence of glucose, explain/describe what would happen, for each mutant, to the expression of the lac operon when you add lactose AND what would happen when the bacteria has used up all of the lactose (if the mutant is able to use lactose).5. Mutations in the lac operator that strengthen the binding of the lac repressor 200 fold 6. Mutations in the promoter that prevent binding of RNA polymerase 7. Mutations in CRP/CAP protein that prevent binding of cAMP8. Mutations in sigma factor that prevent binding of sigma to core RNA polymerase
Molecular Biology Please help and there is an attached image. Thank you. A bacteria has a gene whose protein/enzyme product is involved with the synthesis of a lipid necessary for the synthesis of the cell membrane. Expression of this gene requires the binding of a protein (called ACT) to a control sequence (called INC) next to the promoter. A. Is the expression/regulation of this gene an example of induction or repression?Please explain:B. Is this expression/regulation an example of positive or negative control?C. When the lipid is supplied in the media, the expression of the enzyme is turned off.Describe one likely mechanism for how this “turn off” is accomplished.
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY